Previous Contig 006306:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018E07Sequence317005263 (5)781006306 (5)gb:AE005172_8900782e-44Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC009398_153675
JMSF019H22Sequence519005263 (5)783006306 (5)gb:AY084466_15695561e-51Arabidopsis thaliana clone 108776 mRNA, complete sequence.
JMSF025I17Sequence464006306 (5)gb:AY084466_15695562e-15Arabidopsis thaliana clone 108776 mRNA, complete sequence.395006306 (5)gb:AY084466_15695561e-15Arabidopsis thaliana clone 108776 mRNA, complete sequence.
JMSF037D13Sequence646005263 (5)759006306 (5)gb:AY084466_15695569e-56Arabidopsis thaliana clone 108776 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018E07+ CTTAGGATTGCTGCACTTCATGATCATCGTTACTAAAAGATCT
                      ____________________________________________________________
consensus CTTAGGATTGCTGCACTTCATGATCATCGTTACTAAAAGATCT
 
. : . : . : . : . : . :
rJMSF018E07+ CATTAGCCGGATTTCCAATCGTTTTGTGTGCTTAAATAATTACTGTGCAAAATGCTGGGA
                      ____________________________________________________________
consensus CATTAGCCGGATTTCCAATCGTTTTGTGTGCTTAAATAATTACTGTGCAAAATGCTGGGA
 
. : . : . : . : . : . :
rJMSF018E07+ GAAAACAACAACAATAACACGCTTCCTGTTTTCCTCAACGAGAACGCCTTCCAGTACCCT
                      ____________________________________________________________
consensus GAAAACAACAACAATAACACGCTTCCTGTTTTCCTCAACGAGAACGCCTTCCAGTACCCT
 
. : . : . : . : . : . :
rJMSF037D13+ GAAGAAACTCTGACAAAAGGGCT
rJMSF018E07+ ACTAACACATCAAATCAGCTGCAGTTATTTGGAAACTGAAGAAACTCTGACAAAAGGGCT
rJMSF019H22+ GAAGAAACTCTGACAAAAGGGCT
                      ____________________________________________________________
consensus ACTAACACATCAAATCAGCTGCAGTTATTTGGAAACTGAAGAAACTCTGACAAAAGGGCT
 
. : . : . : . : . : . :
rJMSF037D13+ TCGGGAGATAAAGCGTAGACACATGGCTTCATTTCTGGGTGTGATGCAGAAAGGCATTAG
rJMSF018E07+ TCGGGAGATAAAGCGTAGACACATGGCTTCATTTCTGGGTGTGATGCAGAAAGGCATTAG
rJMSF019H22+ TCGGGAGATAAAGCGTAGACACATGGCTTCATTTCTGGGTGTGATGCAGAAAGGCATTAG
                      ____________________________________________________________
consensus TCGGGAGATAAAGCGTAGACACATGGCTTCATTTCTGGGTGTGATGCAGAAAGGCATTAG
 
. : . : . : . : . : . :
rJMSF037D13+ CAATAAGCTGCACGAGAAGGATGTTGAGCTCGAGAACATAAACCGGAAAAACAAGGAACT
rJMSF018E07+ CAATAAGCTGCACGAGAAGGATGTTGAGCTCGAGAACATAAACCGGAAAAACAAGGAACT
rJMSF019H22+ CAATAAGCTGCACGAGAAGGATGTTGAGCTCGAGAACATAAACCGGAAAAACAAGGAACT
                      ____________________________________________________________
consensus CAATAAGCTGCACGAGAAGGATGTTGAGCTCGAGAACATAAACCGGAAAAACAAGGAACT
 
. : . : . : . : . : . :
rJMSF037D13+ TATCGACAGAATCAAGCAAACGGCTTCAGAAGCCCAGAACTGGTGCTACAGGGCGAAGTA
rJMSF018E07+ TATCGACAGAATCAAGCAAACGGCTTCAGAAGCCCAGAACTGGTGCTACAGGGCGAAGTA
rJMSF019H22+ TATCGACAGAATCAAGCAAACGGCTTCAGAAGCCCAGAACTGGTGCTACAGGGCGAAGTA
                      ____________________________________________________________
consensus TATCGACAGAATCAAGCAAACGGCTTCAGAAGCCCAGAACTGGTGCTACAGGGCGAAGTA
 
. : . : . : . : . : . :
rJMSF037D13+ CAACGAGTCTGTAGCTACGATGCTGAAAGCCAACCTCCAACGTGCAATGCACAGCGCGGA
rJMSF018E07+ CAACGAGTCTGTAGCTACGATGCTGAAAGCCAACCTCCAACGTGCAATGCACAGCGCGGA
rJMSF019H22+ CAACGAGTCTGTAGCTACGATGCTGAAAGCCAACCTCCAACGTGCAATGCACAGCGCGGA
rJMSF025I17+ CGATGCTTAAAGCCAACCTCCAACGTGCAATGCACAGCGCGGA
JMSF025I17- CGATGCTTAAAGCCAACCTCCAACGTGCAATGCACAGCGCGGA
                      ____________________________________________________________
consensus CAACGAGTCTGTAGCTACGATGCTTAAAGCCAACCTCCAACGTGCAATGCACAGCGCGGA
 
. : . : . : . : . : . :
rJMSF037D13+ CCAAGCCAAGGAAGGGTTTGGGGACAGCGAGATGGAGATGGACGATGCTACCTCCGGCGG
rJMSF018E07+ CCAAGCCAAGGAAGGGTTTGGGGACAGCGAGATGGAGATGGACGATGCTACCTCCGGCGG
rJMSF019H22+ CCAAGCCAAGGAAGGGTTTGGGGACAGCGAGATGGAGATGGACGATGCTACCTCCGGCGG
rJMSF025I17+ CCAAGCCAAGGAAGGGTTTGGGGACAGCGAGATGGAGATGGACGATGCTACCTCCGGCGG
JMSF025I17- CCAAGCCAAGGAAGGGTTTGGGGACAGCGAGATGGAGATGGACGATGCTACCTCCGGCGG
                      ____________________________________________________________
consensus CCAAGCCAAGGAAGGGTTTGGGGACAGCGAGATGGAGATGGACGATGCTACCTCCGGCGG
 
. : . : . : . : . : . :
rJMSF037D13+ GGTCCACCCCAAGTTCGGCCTAAGCGTCGGGGCGGGGGGTGGTGGGAGTCCCGCAAAACC
rJMSF018E07+ GGTCCACCCCAAGTTCGGCCTAAGCGTCGGGGCGGGGGGTGGTGGGAGTCCCGCAAAACC
rJMSF019H22+ GGTCCACCCCAAGTTCGGCCTAAGCGTCGGGGCGGGGGGTGGTGGGAGTCCCGCAAAACC
rJMSF025I17+ GGTCCACCCCAAGTTCGGCCTAAGCGTCGGGGCGGGGGGTGGTGGGAGTCCCGCAAAACC
JMSF025I17- GGTCCACCCCAAGTTCGGCCTAAGCGTCGGGGCGGGGGGTGGTGGGAGTCCCGCAAAACC
                      ____________________________________________________________
consensus GGTCCACCCCAAGTTCGGCCTAAGCGTCGGGGCGGGGGGTGGTGGGAGTCCCGCAAAACC
 
. : . : . : . : . : . :
rJMSF037D13+ ACCACCACAACAAGCGAGGGAGTTGTTGATTTGCAGAGGCTGCAAATCGAAGGAGGTATC
rJMSF018E07+ ACCACCACAACAAGCGAGGGAGTTGTTGATTTGCAGAGGCTGCAAATCGAAGGAGGTATC
rJMSF019H22+ ACCACCACAACAAGCGAGGGAGTTGTTGATTTGCAGAGGCTGCAAATCGAAGGAGGTATC
rJMSF025I17+ ACCACCACAACAAGCGAGGGAGTTGTTGATTTGCAGAGGCTGCAAATCGAAGGAGGTATC
JMSF025I17- ACCACCACAACAAGCGAGGGAGTTGTTGATTTGCAGAGGCTGCAAATCGAAGGAGGTATC
                      ____________________________________________________________
consensus ACCACCACAACAAGCGAGGGAGTTGTTGATTTGCAGAGGCTGCAAATCGAAGGAGGTATC
 
. : . : . : . : . : . :
rJMSF037D13+ CATCTTATTGTTGCCTTGCAGGCACCTGTGTTTGTGTGTAGATTGTGAGGGGTCGGTGAG
rJMSF018E07+ CATCTTATTGTTGCCTTGCAGGCACCTGTGTTTGTGTGTAGATTGTGAGGGGTCGGTGAG
rJMSF019H22+ CATCTTATTGTTGCCTTGCAGGCACCTGTGTTTGTGTGTAGATTGTGAGGGGTCGGTGAG
rJMSF025I17+ CATCTTATTGTTGCCTTGCAGGCACCTGTGTTTGTGTGTAGATTGTGAGGGGTCGGTGAG
JMSF025I17- CATCTTATTGTTGCCTTGCAGGCACCTGTGTTTGTGTGTAGATTGTGAGGGGTCGGTGAG
                      ____________________________________________________________
consensus CATCTTATTGTTGCCTTGCAGGCACCTGTGTTTGTGTGTAGATTGTGAGGGGTCGGTGAG
 
. : . : . : . : . : . :
rJMSF037D13+ TGTCTGCCCCGTGTGCCAAATGGTTACGGCCACTACTGTCCGGGTTTATCTGTCTTGAAA
rJMSF018E07+ TGTCTGCCCCGTGTGCCAAATGGTTACGGCCACTACTGTCCGGGTTTATCTGTCTTGAAA
rJMSF019H22+ TGTCTGCCCCGTGTGCCAAATGGTTACGGCCACTACTGTCCGGGTTTATCTGTCTTGAAA
rJMSF025I17+ TGTCTGCCCCGTGTGCCAAATGGTTACGGCCACTACTGTCCGGGTTTATCTGTCTTGAAA
JMSF025I17- TGTCTGCCCCGTGTGCCAAATGGTTACGGCCACTACTGTCCGGGTTTATCTGTCTTGAAA
                      ____________________________________________________________
consensus TGTCTGCCCCGTGTGCCAAATGGTTACGGCCACTACTGTCCGGGTTTATCTGTCTTGAAA
 
. : . : . : . : . : . :
rJMSF037D13+ TATCATCAACCAAACCAT
rJMSF018E07+ TATCATCAACCAAACCAT
rJMSF019H22+ TATCATCAACCAAACCATAATACCCCTTACAGTTGAAAGAATATATATATTTAACCTGAA
rJMSF025I17+ TATCATCAACCAAACCATAATACCCCTTACAGTTGAAAGAATATATATATT
JMSF025I17- TATCATCAACCAAACCATAATACCCCTTACAGTTGAAAGAATATATATATTTAACTTGAA
                      ____________________________________________________________
consensus TATCATCAACCAAACCATAATACCCCTTACAGTTGAAAGAATATATATATTTAACTTGAA
 
. : . : . : . : . : . :
rJMSF019H22+ AAAC
JMSF025I17- AAACAATGGTGTGAGTGAAAGGTGTGGAATAGTAAACAAGCTTTCTTGATNAAAAAAAAA
                      ____________________________________________________________
consensus AAACAATGGTGTGAGTGAAAGGTGTGGAATAGTAAACAAGCTTTCTTGATNAAAAAAAAA