Previous Contig 006303:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015I01Sequence613006303 (8)gb:AP000381_18198663e-11Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.656010312 (5)gb:AP000381_18198664e-21Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.
JMFF043H02Sequence639006303 (8)gb:AP000381_18198665e-12Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.599010312 (5)gb:AP000381_18198662e-08Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.
JMFS015G10Sequence544006303 (8)gb:AP000381_18198666e-06Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.
JMFS097F07Sequence611006303 (8)gb:AP000381_18198667e-12Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.
JMFS108C12Sequence617006303 (8)gb:AP000381_18198667e-12Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.
JMFS145A09Sequence620006303 (8)gb:AP000381_18198667e-12Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.
JMSF025I02Sequence704006303 (8)gb:AP000381_18198661e-09Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.740010312 (5)gb:AP000381_18198668e-18Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.
JMSF026E24Sequence622006303 (8)gb:AP000381_18198667e-12Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.716010312 (5)gb:AP000381_18198668e-17Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K17E12.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS145A09+ GA
JMSF026E24+ TGGA
JMFS108C12+ TGGA
JMFS097F07+ GA
JMFF043H02+ GCAGATCAATTTTCTTCTGGA
                      ____________________________________________________________
consensus GCAGATCAATTTTCTTCTGGA
 
. : . : . : . : . : . :
JMFF015I01+ ACGAGTCCGTTCGAGTTCAGATTTCAACTGCAGTAGTAAGTTCCATCTCTCAGATG
JMFS145A09+ GAATACGAGTCCGTTCGAGTTCAGATTTCAACTGCAGTACTAAGTTCCATCTCTCAGATG
JMSF026E24+ GAATACGAGTCCGTTCGAGTTCAGATTTCAACTGCAGTACTAAGTTCCATCTCTCAGATG
JMFS108C12+ GAATACGAGTCCGTTCGAGTTCAGATTTCAACTGCAGTACTAAGTTCCATCTCTCAGATG
JMFS015G10+ G
JMFS097F07+ GAATACGAGTCCGTTCGAGTTCAGATTTCAACTGCAGTACTAAGTTCCATCTCTCAGATG
JMFF043H02+ GAATACGAGTCCGTTCGAGTTCAGATTTCAACTGCAGTACTAAGTTCCATCTCTCAGATG
JMSF025I02+ GAGTTCAGATTTCAACTGCAGTACTAAGTTCCATCTCTCAGATG
                      ____________________________________________________________
consensus GAATACGAGTCCGTTCGAGTTCAGATTTCAACTGCAGTACTAAGTTCCATCTCTCAGATG
 
. : . : . : . : . : . :
JMFF015I01+ GAGAGAGTTGAGCCAAAGGTATAACTTGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
JMFS145A09+ GAGAGAGTTGAGCCAAAGGTATAACTTGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
JMSF026E24+ GAGAGAGTTGAGCCAAAGGTATAACTTGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
JMFS108C12+ GAGAGAGTTGAGCCAAAGGTATAACTTGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
JMFS015G10+ GAGAGAGTTGAGCCAAAGGTATAACTTGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
JMFS097F07+ GAGAGAGTTGAGCCAAAGGTATAACTTGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
JMFF043H02+ GAGAGAGTTGAGCCAAAGGTATAACTNGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
JMSF025I02+ GAGAGAGTTGAGCCAAAGGTATAACTTGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
                      ____________________________________________________________
consensus GAGAGAGTTGAGCCAAAGGTATAACTTGTAGGGGCACAGCAAAACCATCATTAGAAGAAG
 
. : . : . : . : . : . :
JMFF015I01+ AATTTAAATTAATCCACTTTCTTNTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
JMFS145A09+ AATTTAAATTAATCCACTTTCTTCTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
JMSF026E24+ AATTTAAATTAATCCACTTTCTTCTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
JMFS108C12+ AATTTAAATTAATCCACTTTCTTCTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
JMFS015G10+ AATTTAAATTAATCCACTTTCTTCTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
JMFS097F07+ AATTTAAATTAATCCACTTTCTTCTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
JMFF043H02+ AATTTAAATTAATCCACTTTCTTCTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
JMSF025I02+ AATTTAAATTAATCCACTTTCTTCTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
                      ____________________________________________________________
consensus AATTTAAATTAATCCACTTTCTTCTAGGGGCAGTTGAAGCCTGTGAAACCCCCATTTCTG
 
. : . : . : . : . : . :
JMFF015I01+ TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
JMFS145A09+ TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
JMSF026E24+ TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
JMFS108C12+ TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
JMFS015G10+ TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
JMFS097F07+ TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
JMFF043H02+ TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
JMSF025I02+ TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
                      ____________________________________________________________
consensus TATCAATTCTTCCCGAACTGCCAGAATCTTCCAACTCATAATTAGTGGCAAAGCCAGCAG
 
. : . : . : . : . : . :
JMFF015I01+ AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
JMFS145A09+ AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
JMSF026E24+ AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
JMFS108C12+ AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
JMFS015G10+ AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
JMFS097F07+ AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
JMFF043H02+ AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
JMSF025I02+ AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
                      ____________________________________________________________
consensus AATATCCTCCTGAAAACCTATCCTTCTTCGACACCATCTTTCATACCATACTCCCACGGT
 
. : . : . : . : . : . :
JMFF015I01+ TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
JMFS145A09+ TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
JMSF026E24+ TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
JMFS108C12+ TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
JMFS015G10+ TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
JMFS097F07+ TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
JMFF043H02+ TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
JMSF025I02+ TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
                      ____________________________________________________________
consensus TCCTTTTATCCACTAGGCACAATACCCATATCTTCGCATAGCCTCGGTATTCTAGTCCCT
 
. : . : . : . : . : . :
JMFF015I01+ GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
JMFS145A09+ GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
JMSF026E24+ GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
JMFS108C12+ GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
JMFS015G10+ GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
JMFS097F07+ GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
JMFF043H02+ GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
JMSF025I02+ GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
                      ____________________________________________________________
consensus GGATCCGGAGCGCTTTCACTCGGCAACCAGAGAAGGAAACCCTATTCCTCCATCAATTCG
 
. : . : . : . : . : . :
JMFF015I01+ ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
JMFS145A09+ ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
JMSF026E24+ ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
JMFS108C12+ ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
JMFS015G10+ ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
JMFS097F07+ ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
JMFF043H02+ ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
JMSF025I02+ ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
                      ____________________________________________________________
consensus ATCCAATTCCTAACATTCAAAATATATTTCGGGGCGGGCAAATTATAAAAAATACATATA
 
. : . : . : . : . : . :
JMFF015I01+ TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
JMFS145A09+ TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
JMSF026E24+ TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
JMFS108C12+ TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
JMFS015G10+ TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
JMFS097F07+ TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
JMFF043H02+ TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
JMSF025I02+ TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
                      ____________________________________________________________
consensus TAAGAAAGAGAAAGTGCAATTCTTGCAAACCCTAGGAGGAGGAGGAGGAGAGTAGCAGAG
 
. : . : . : . : . : . :
JMFF015I01+ ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
JMFS145A09+ ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
JMSF026E24+ ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
JMFS108C12+ ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
JMFS015G10+ ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
JMFS097F07+ ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
JMFF043H02+ ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
JMSF025I02+ ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
                      ____________________________________________________________
consensus ATAAACGGATGCGGTATCGGCGGCGATCGCGATCGCAATCGAAGCGGCTGAAAGCAGAGG
 
. : . : . : . : . : . :
JMFF015I01+ AAAGCTCCCTCAGCTCC
JMFS145A09+ AAAGCTCCCTCAGCTCC
JMSF026E24+ AAAGCTCCCTCAGCTCC
JMFS108C12+ AAAGCTCCCTCAG
JMFS015G10+ AAA
JMFS097F07+ AAAGCTCCC
JMFF043H02+ AAAGCTCCCTCAGCTCC
JMSF025I02+ AAAGCTCCCTCAGCTCCACGGAGAGAGAGAAAAAACGAAAAGGAAGGAGTTTTCTAGCCC
                      ____________________________________________________________
consensus AAAGCTCCCTCAGCTCCACGGAGAGAGAGAAAAAACGAAAAGGAAGGAGTTTTCTAGCCC
 
. : . : . : . : . : . :
JMSF025I02+ GGCCGTCCTATTAAAGATCTGAGCCGTAGATCTCGATTCCGGCTTCACTGAAGCGGTGTC
                      ____________________________________________________________
consensus GGCCGTCCTATTAAAGATCTGAGCCGTAGATCTCGATTCCGGCTTCACTGAAGCGGTGTC