Previous Contig 006302:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025H21Sequence129006302 (2)340012416 (2)gb:AP003511_18301442e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P057
JMSF035J21Sequence580006302 (2)gb:AK176541_18185292e-50Arabidopsis thaliana mRNA, partial cds, clone: RAFL25-06-C11.>gb:AK176734_181872629012416 (2)gb:AP003511_18301448e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P057

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035J21+ GAGTTTAGAACCTCTCCAAGTGTTATTGCACGACCATCAC
                      ____________________________________________________________
consensus GAGTTTAGAACCTCTCCAAGTGTTATTGCACGACCATCAC
 
. : . : . : . : . : . :
JMSF035J21+ CTAACTGGCCAGCCCACATTCCAAATTGATGCCCTCCATAGTTTTGGGCATAAGGCATCG
                      ____________________________________________________________
consensus CTAACTGGCCAGCCCACATTCCAAATTGATGCCCTCCATAGTTTTGGGCATAAGGCATCG
 
. : . : . : . : . : . :
JMSF035J21+ ATCCCACCAAAGGTGAAGCTCCAGAGAATAACAGTGGGAAATCTGATCTCTCGAATTCTT
                      ____________________________________________________________
consensus ATCCCACCAAAGGTGAAGCTCCAGAGAATAACAGTGGGAAATCTGATCTCTCGAATTCTT
 
. : . : . : . : . : . :
JMSF035J21+ TAGGATCCAATTCAAGAACCTTGGCAACCGAGTCTGACCATGCAACAAGCTGGGGATTCT
                      ____________________________________________________________
consensus TAGGATCCAATTCAAGAACCTTGGCAACCGAGTCTGACCATGCAACAAGCTGGGGATTCT
 
. : . : . : . : . : . :
JMSF035J21+ CCACCTCAGCAGAGGGAGATAACTTAGTATAGCAAGCATGCAACACCTCCCTGGGCATGT
                      ____________________________________________________________
consensus CCACCTCAGCAGAGGGAGATAACTTAGTATAGCAAGCATGCAACACCTCCCTGGGCATGT
 
. : . : . : . : . : . :
JMSF035J21+ TATCGGTCCTGGGATCACCCGGCAGTTCTCGAACGAAAGAATGATCCCAATTTAGCTCTT
                      ____________________________________________________________
consensus TATCGGTCCTGGGATCACCCGGCAGTTCTCGAACGAAAGAATGATCCCAATTTAGCTCTT
 
. : . : . : . : . : . :
JMSF035J21+ GGAGCTTGAGTTTACAACTGGTGGAACTCTCCAAGCTCTGTTTCCCGAAACCATCGGTTA
                      ____________________________________________________________
consensus GGAGCTTGAGTTTACAACTGGTGGAACTCTCCAAGCTCTGTTTCCCGAAACCATCGGTTA
 
. : . : . : . : . : . :
JMSF035J21+ CTGAATCGACGGTGGCGGAGGCGGCAGCGGCAGCGGTGGAGGGCGGTGGGGAGTCCATGG
                      ____________________________________________________________
consensus CTGAATCGACGGTGGCGGAGGCGGCAGCGGCAGCGGTGGAGGGCGGTGGGGAGTCCATGG
 
. : . : . : . : . : . :
JMSF035J21+ ACGCAGTGAATAAGGGGCGGCGGCGCAGTTGCAGCGGCCTGCAGGGGAATCTGGGGCAGA
JMSF025H21+ GCAGA
                      ____________________________________________________________
consensus ACGCAGTGAATAAGGGGCGGCGGCGCAGTTGCAGCGGCCTGCAGGGGAATCTGGGGCAGA
 
. : . : . : . : . : . :
JMSF035J21+ GATGTTTGGGGATGTATAGGGCGGTGGCGGTGAGGGAAGAAGCAGGGGCGTGAGAGAGC
JMSF025H21+ GATGTTTGGGGATGTATAGGGCGGTGNCGGTGAGGGAAGAAGCAGGGGCGTGAGAGAGCG
                      ____________________________________________________________
consensus GATGTTTGGGGATGTATAGGGCGGTGGCGGTGAGGGAAGAAGCAGGGGCGTGAGAGAGCG
 
. : . : . : . : . : . :
JMSF025H21+ AAGCCGAGAAATGGGCAAGCATTTGCATTTTTAACCACTCTCCNGTCAAGTGTGTAGCCA
                      ____________________________________________________________
consensus AAGCCGAGAAATGGGCAAGCATTTGCATTTTTAACCACTCTCCNGTCAAGTGTGTAGCCA