Previous Contig 006298:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025H06Sequence668006298 (2)716012415 (2)gb:AY079161_15681857e-24Arabidopsis thaliana At2g04305/T23O15.7 mRNA, complete cds.>gb:BT002705_1636308
JMSF047I13Sequence698006298 (2)gb:AY079161_15681853e-44Arabidopsis thaliana At2g04305/T23O15.7 mRNA, complete cds.>gb:BT002705_1636308 743012415 (2)gb:AY079161_15681853e-37Arabidopsis thaliana At2g04305/T23O15.7 mRNA, complete cds.>gb:BT002705_1636308

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047I13+ CAGAAATTCTAAACGTAAATTTACTCATGGCA
                      ____________________________________________________________
consensus CAGAAATTCTAAACGTAAATTTACTCATGGCA
 
. : . : . : . : . : . :
JMSF047I13+ GGACCAGGTGAATTTACCCTAAAGACAAGAGCACCATCAACATGCCCACAAAAGGGTCCG
                      ____________________________________________________________
consensus GGACCAGGTGAATTTACCCTAAAGACAAGAGCACCATCAACATGCCCACAAAAGGGTCCG
 
. : . : . : . : . : . :
JMSF047I13+ TTGCTAACGAGGGACAGAATGTCTTGGAGCTTCAATGGAGGGCAGAGAACATCAATAAGA
                      ____________________________________________________________
consensus TTGCTAACGAGGGACAGAATGTCTTGGAGCTTCAATGGAGGGCAGAGAACATCAATAAGA
 
. : . : . : . : . : . :
JMSF047I13+ TACTGTGCAGATTGCGAAATCTTGTGGTTCAGCTTAGGAAGTTCCACATGGTACCAACAA
                      ____________________________________________________________
consensus TACTGTGCAGATTGCGAAATCTTGTGGTTCAGCTTAGGAAGTTCCACATGGTACCAACAA
 
. : . : . : . : . : . :
JMSF047I13+ AACTCTTTCCCTCTACCCTCTGACAAATCCCATTCCTTGTTGAAGTAGCCCCCTTCTCCA
                      ____________________________________________________________
consensus AACTCTTTCCCTCTACCCTCTGACAAATCCCATTCCTTGTTGAAGTAGCCCCCTTCTCCA
 
. : . : . : . : . : . :
JMSF047I13+ TCAAAAATATATGCTTTCACTCTCACAGCCCCCGAACAACGCACCAGAAAATCATTATTC
                      ____________________________________________________________
consensus TCAAAAATATATGCTTTCACTCTCACAGCCCCCGAACAACGCACCAGAAAATCATTATTC
 
. : . : . : . : . : . :
JMSF047I13+ TCCCCAATATTAGTATGTGTTAGTGGCATTGTTTCCATTTCCTCTTCTACTTCTCCCCCT
JMSF025H06+ CTCCCCCT
                      ____________________________________________________________
consensus TCCCCAATATTAGTATGTGTTAGTGGCATTGTTTCCATTTCCTCTTCTACTTCTCCCCCT
 
. : . : . : . : . : . :
JMSF047I13+ CTCTCTCTGTTCATCCTCTCATGAATAAGTTCCATGTTCATAAAAACTTTCACTCATCAG
JMSF025H06+ CTCTCTCTGTTCATCCTCTCATGAATAAGTTCCATGTTCATAAAAACTTTCACTCATCAG
                      ____________________________________________________________
consensus CTCTCTCTGTTCATCCTCTCATGAATAAGTTCCATGTTCATAAAAACTTTCACTCATCAG
 
. : . : . : . : . : . :
JMSF047I13+ CTAAAGTAAAAAAGAATAAGAAACCCCGATACAAGCAAGCTCTTTTGTTCAACAATCGCT
JMSF025H06+ CTAAAGTAAAAAAGAATAAGAAACCCCGATACAAGCAAGCTCTTTTGTTCAACAATCGCT
                      ____________________________________________________________
consensus CTAAAGTAAAAAAGAATAAGAAACCCCGATACAAGCAAGCTCTTTTGTTCAACAATCGCT
 
. : . : . : . : . : . :
JMSF047I13+ CGAAGTTC
JMSF025H06+ CGAAGTTCTAGAAGAACAACAATTCAGTTTAGAAAGGATGAAGCACACGCCAATAACCTC
                      ____________________________________________________________
consensus CGAAGTTCTAGAAGAACAACAATTCAGTTTAGAAAGGATGAAGCACACGCCAATAACCTC
 
. : . : . : . : . : . :
JMSF025H06+ CGCCTAATCAGCGCAATTATAACAGAATTCAATGAACACTGGATATAAATGAAATCAAAA
                      ____________________________________________________________
consensus CGCCTAATCAGCGCAATTATAACAGAATTCAATGAACACTGGATATAAATGAAATCAAAA
 
. : . : . : . : . : . :
JMSF025H06+ GAAATGAAAATCTCGAGTAATCTGAAATCTGCAACAAATTCATGAACACCAGATTACCCG
                      ____________________________________________________________
consensus GAAATGAAAATCTCGAGTAATCTGAAATCTGCAACAAATTCATGAACACCAGATTACCCG
 
. : . : . : . : . : . :
JMSF025H06+ ATAGTCATGCACCAACTTCGCATCATATCTATTCTCACCAATTAAGCAGGGGTTTTACCT
                      ____________________________________________________________
consensus ATAGTCATGCACCAACTTCGCATCATATCTATTCTCACCAATTAAGCAGGGGTTTTACCT
 
. : . : . : . : . : . :
JMSF025H06+ CGTTCAAACAGCTCAAAGAAACTGCAAGCAACTCCGGTATAAATCCAATCATGAAAATCC
                      ____________________________________________________________
consensus CGTTCAAACAGCTCAAAGAAACTGCAAGCAACTCCGGTATAAATCCAATCATGAAAATCC
 
. : . : . : . : . : . :
JMSF025H06+ CTACAAAACCAACCAAAAACCACCCAAATACAAATGGTTCTATGTAAGCCGCCGAATGAA
                      ____________________________________________________________
consensus CTACAAAACCAACCAAAAACCACCCAAATACAAATGGTTCTATGTAAGCCGCCGAATGAA
 
. : . : . : . : . : . :
JMSF025H06+ GAAAAGCGAACGAAACTTTAGGAAAGAAACTGTGTATGATTTTCTCTGCGTGTACTCAAA
                      ____________________________________________________________
consensus GAAAAGCGAACGAAACTTTAGGAAAGAAACTGTGTATGATTTTCTCTGCGTGTACTCAAA
 
. : . : . : . : . : . :
JMSF025H06+ GTCAACTCACAAATGCGATCATGGAAACGAATGAAGAAGTCGGAAATCGGAAAGAAGACC
                      ____________________________________________________________
consensus GTCAACTCACAAATGCGATCATGGAAACGAATGAAGAAGTCGGAAATCGGAAAGAAGACC
 
. : . : . : . : . : . :
JMSF025H06+ TGCTCTATCTAGAATTCTGACCAAAGAATGAAACTTTCCTCTAAACCACCGTCACCTCCC
                      ____________________________________________________________
consensus TGCTCTATCTAGAATTCTGACCAAAGAATGAAACTTTCCTCTAAACCACCGTCACCTCCC