Previous Contig 006296:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002J04Sequence239006296 (3)662006296 (3)gb:AC134927_17418744e-25Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete seq
JMSF025H02Sequence660006296 (3)gb:AC134927_17418744e-14Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete seq722023172gb:AC134927_17418749e-13Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002J04- AGATTCAGCACACATGT
                      ____________________________________________________________
consensus AGATTCAGCACACATGT
 
. : . : . : . : . : . :
rJMSF002J04- ACATGGCCAAAGTTTATGTGTATAATCTACAAACGAAAACCAAAAACTAATGACAGAAAG
                      ____________________________________________________________
consensus ACATGGCCAAAGTTTATGTGTATAATCTACAAACGAAAACCAAAAACTAATGACAGAAAG
 
. : . : . : . : . : . :
rJMSF002J04- AATCATCGTACAAGTGTCTGGTATGATGGTGTAATCAAATGTAGGACTGGCGAGAAAATT
                      ____________________________________________________________
consensus AATCATCGTACAAGTGTCTGGTATGATGGTGTAATCAAATGTAGGACTGGCGAGAAAATT
 
. : . : . : . : . : . :
rJMSF002J04- TATATCCAGAAATGACAGCCGAAATCGCCATAGCAAGGAATGCCAAGAACTCCATACTTA
                      ____________________________________________________________
consensus TATATCCAGAAATGACAGCCGAAATCGCCATAGCAAGGAATGCCAAGAACTCCATACTTA
 
. : . : . : . : . : . :
rJMSF002J04- TAGCTGATGCAGAGGAATCAGTAAATAGGTTGTCATTGTTTTCTCTCATCTTATTTGTCA
                      ____________________________________________________________
consensus TAGCTGATGCAGAGGAATCAGTAAATAGGTTGTCATTGTTTTCTCTCATCTTATTTGTCA
 
. : . : . : . : . : . :
rJMSF002J04- GTGGCACTGCAGATGATGCTGAGGATATTAACAAGTATGCTGCCACCTGATCACCAAAAA
JMSF025H02+ ACCTGATCACCAAAAA
                      ____________________________________________________________
consensus GTGGCACTGCAGATGATGCTGAGGATATTAACAAGTATGCTGCCACCTGATCACCAAAAA
 
. : . : . : . : . : . :
rJMSF002J04- AGTCTATCATAGCCCAATTTCGTCCGGAAGAGTATATTTTTCCGGTGGAAAGTTCATGGA
JMSF025H02+ AGTCTATCATAGCCCAATTTCGTCCGGAAGAGTATATTTTTCCGGTGGAAAGTTCATGGA
                      ____________________________________________________________
consensus AGTCTATCATAGCCCAATTTCGTCCGGAAGAGTATATTTTTCCGGTGGAAAGTTCATGGA
 
. : . : . : . : . : . :
rJMSF002J04- GTTGCCGGAAAGTCTGCAGTCCAGAATACAGAGTAGACAGAATCGATATTGCCAGCACAT
JMSF025H02+ GTTGCCGGAAAGTCTGCAGTCCAGAATACAGAGTAGACAGAATCGATATTGCCAGCACAT
                      ____________________________________________________________
consensus GTTGCCGGAAAGTCTGCAGTCCAGAATACAGAGTAGACAGAATCGATATTGCCAGCACAT
 
. : . : . : . : . : . :
rJMSF002J04- ACCT
JMSF025H02+ ACCTGTATTCCTCGTATCTGTCGAAATCTTTCCAATCCCCATGCTTATTACTAGCCATGA
                      ____________________________________________________________
consensus ACCTGTATTCCTCGTATCTGTCGAAATCTTTCCAATCCCCATGCTTATTACTAGCCATGA
 
. : . : . : . : . : . :
JMSF025H02+ TGATGAAGGCGAGCAAGGAGAAGAGCAGAGCGGCGGCGCGAGCGCCCAAAGAAGATTTCT
                      ____________________________________________________________
consensus TGATGAAGGCGAGCAAGGAGAAGAGCAGAGCGGCGGCGCGAGCGCCCAAAGAAGATTTCT
 
. : . : . : . : . : . :
JMSF002J04+ AGCAAATCCTCCNTCTTCCACCGCCGGACGATGTTCCCCACTCCGGTACCCATCCCCG
JMSF025H02+ TGAGCAAATCCTCCCTCTTCCACCGCCGGACGATGTTCCCCACTCCGGTACCCATCCCCG
                      ____________________________________________________________
consensus TGAGCAAATCCTCCCTCTTCCACCGCCGGACGATGTTCCCCACTCCGGTACCCATCCCCG
 
. : . : . : . : . : . :
JMSF002J04+ CCGCCGTCTGGCTCTCGACATCCCGGGCGCCGGCGCCGGGAGGTGGCGGTATCGGAGCCG
JMSF025H02+ CCGCCGTCTGGCTCTCGACATCCCGGGCGCCGGCGCCGGGAGGTGGCGGTATCGGAGCCG
                      ____________________________________________________________
consensus CCGCCGTCTGGCTCTCGACATCCCGGGCGCCGGCGCCGGGAGGTGGCGGTATCGGAGCCG
 
. : . : . : . : . : . :
JMSF002J04+ GCACAGTCTCCGCCTCTTTCGCCGAATTATCCATGAGATCCGACATATTCTCCTGGGAAT
JMSF025H02+ GCACAGTCTCCGCCTCTTTCGCCGAATTATCCATGAGATCCGACATATTCTCCTGGGAAT
                      ____________________________________________________________
consensus GCACAGTCTCCGCCTCTTTCGCCGAATTATCCATGAGATCCGACATATTCTCCTGGGAAT
 
. : . : . : . : . : . :
JMSF002J04+ CAGAGATCTTTGAGTACGGTGAAACAATCGACTAAGAACAAAAATCTCTGCTAAGAAG
JMSF025H02+ CAGAGATCTTTGAGTACGGTGAAACAATCGACTAAGAACAAAAATCTCTGCTAAGAAGTC
                      ____________________________________________________________
consensus CAGAGATCTTTGAGTACGGTGAAACAATCGACTAAGAACAAAAATCTCTGCTAAGAAGTC
 
. : . : . : . : . : . :
JMSF025H02+ AAGTGAATAGAAGAATGGAGGGTGGATCGGATATGATGTGGCTTGGAAGGGAGACAATTC
                      ____________________________________________________________
consensus AAGTGAATAGAAGAATGGAGGGTGGATCGGATATGATGTGGCTTGGAAGGGAGACAATTC