Previous Contig 006294:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS119E02Sequence616006294 (2)gb:AY830138_16293397e-21Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.
JMSF025G17Sequence663006294 (2)gb:AY830138_16293392e-17Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.742023169

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025G17+ TTCAATAAG
                      ____________________________________________________________
consensus TTCAATAAG
 
. : . : . : . : . : . :
JMSF025G17+ CAGCCTCGCAGGGTAGAAAGTTGCTGTGAGAAATATGCCATTGCTATTGCTGCTTTATCA
                      ____________________________________________________________
consensus CAGCCTCGCAGGGTAGAAAGTTGCTGTGAGAAATATGCCATTGCTATTGCTGCTTTATCA
 
. : . : . : . : . : . :
JMSF025G17+ TCAAAACCATACACCTTTGGGAAGTATTGCTCAATTTTTTTGATGAGACTAGTTAAAGCA
                      ____________________________________________________________
consensus TCAAAACCATACACCTTTGGGAAGTATTGCTCAATTTTTTTGATGAGACTAGTTAAAGCA
 
. : . : . : . : . : . :
JMFS119E02+ CAACAGCTCTGTTGCATATTTTGTAGCTTCTTGCAAA
JMSF025G17+ ACACTACACATTTTTGATGAGTACAACAGGTCTGTTGCATATTTTGCAGCTTCTTTCAAA
                      ____________________________________________________________
consensus ACACTACACATTTTTGATGAGTACAACAGGTCTGTTGCATATTTTGTAGCTTCTTTCAAA
 
. : . : . : . : . : . :
JMFS119E02+ GTTTGAT---GGAGGAGTTGATGGGAAGCTGCAGCTTTTTCTCC---TCCGAGAAGGATG
JMSF025G17+ GTTTGATGGAGGAGGAGTTGATGGGAAGCTGCAGCTTTTTCTCCGTGTTGATGAAGGATG
                      ____________________________________________________________
consensus GTTTGATGGAGGAGGAGTTGATGGGAAGCTGCAGCTTTTTCTCCGTGTTGGTGAAGGATG
 
. : . : . : . : . : . :
JMFS119E02+ AAGTTGCTAAGGTGTAGTTCAATATCATCTTCAGCTTTGAGTGCAAAGTCTCTGATTTCC
JMSF025G17+ AAGTTGCTAAGGTGTAGTTCAATGTCGTCTTCAGCTTTGAGTGCAAACTCTCTGATTTCC
                      ____________________________________________________________
consensus AAGTTGCTAAGGTGTAGTTCAATGTCGTCTTCAGCTTTGAGTGCAAAGTCTCTGATTTCC
 
. : . : . : . : . : . :
JMFS119E02+ ATTTCTAAATCTCTCACTTTCACTGCATAACCATCACCATCACCACTGGATTCCTTCTGG
JMSF025G17+ ACTTCTAAATCTCTGACTTTGAGTACTG---CATCACCATCACCACTGGATTCCATCTGG
                      ____________________________________________________________
consensus ATTTCTAAATCTCTGACTTTGAGTGCTTAACCATCACCATCACCACTGGATTCCTTCTGG
 
. : . : . : . : . : . :
JMFS119E02+ AGAAGGGCTTGCAAAGCATAAAGTTTTTCAAGGAAAGACTTGATTCCTGCTCGATCATGA
JMSF025G17+ AGAAGGGCTTGCAAATAAGAAAGGTTTTCAAGGAAAGCGTTGATTCCTGCTCGATCATGA
                      ____________________________________________________________
consensus AGAAGGGCTTGCAAATCATAAAGTTTTTCAAGGAAAGCGTTGATTCCTGCTCGATCATGA
 
. : . : . : . : . : . :
JMFS119E02+ TCATGGAGATACAGGCTTACCCTTTCTGTTTGCCCAACGACAAACTCAATCTCAATGGTT
JMSF025G17+ TCATGGAGAGACAGGCTTACCCTTGCTGTTTTCCGA---AGAAACTCAATCTCAATGGTT
                      ____________________________________________________________
consensus TCATGGAGATACAGGCTTACCCTTTCTGTTTTCCGAACGAGAAACTCAATCTCAATGGTT
 
. : . : . : . : . : . :
JMFS119E02+ TTAATGAGAGAAGCTAAAGCAACACAAGCCATCTATCTCTCAATTCCAATCTTTAATTTA
JMSF025G17+ TTAATCAGAGAAGCTAAAGCAACACAAGCCATCTATCTCTCAATTCCAATCTTTAATTTA
                      ____________________________________________________________
consensus TTAATGAGAGAAGCTAAAGCAACACAAGCCATCTATCTCTCAATTCCAATCTTTAATTTA
 
. : . : . : . : . : . :
JMFS119E02+ ATTTGCTGGATGGTAAGAATATGTATGTAGTTTTAAGTTTTGGTATTGCACACTG-ATAA
JMSF025G17+ ACTTGCTGGATGGTAAGAATATGTATGTAGTTTTAAGTTTTGGTATTGCACACTGAAAAA
                      ____________________________________________________________
consensus ATTTGCTGGATGGTAAGAATATGTATGTAGTTTTAAGTTTTGGTATTGCACACTGAATAA
 
. : . : . : . : . : . :
JMFS119E02+ CTAGATCAATCAAATATGCAAGCAA
JMSF025G17+ CTAGATCGATCAAATATGCAAGCAAGACTCTGATCTGAGAAGAGCTTAAATTAGCTTATC
                      ____________________________________________________________
consensus CTAGATCGATCAAATATGCAAGCAAGACTCTGATCTGAGAAGAGCTTAAATTAGCTTATC