Previous Contig 006292:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025G11Sequence649006292 (3)gb:AY059774_15646241e-42Arabidopsis thaliana unknown protein (At2g35155) mRNA, complete cds.770013563 (2)gb:AY099637_15766623e-32Arabidopsis thaliana putative protein (At5g45030) mRNA, complete cds.>gb:BT00216
JMSF027O18Sequence667006292 (3)gb:AY059774_15646244e-43Arabidopsis thaliana unknown protein (At2g35155) mRNA, complete cds.771012574 (2)gb:AY099637_15766625e-47Arabidopsis thaliana putative protein (At5g45030) mRNA, complete cds.>gb:BT00216
JMSF044L22Sequence721006292 (3)gb:AY059774_15646242e-59Arabidopsis thaliana unknown protein (At2g35155) mRNA, complete cds.758013563 (2)gb:AY099637_15766622e-47Arabidopsis thaliana putative protein (At5g45030) mRNA, complete cds.>gb:BT00216

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044L22+ TCTACATCACA
                      ____________________________________________________________
consensus TCTACATCACA
 
. : . : . : . : . : . :
JMSF044L22+ CCAAACACCTCCTGGACCCTCTAAAACAGAAGGAAGACATTGTATAGGACTAAGCCATTG
JMSF027O18+ AGCCATTG
                      ____________________________________________________________
consensus CCAAACACCTCCTGGACCCTCTAAAACAGAAGGAAGACATTGTATAGGACTAAGCCATTG
 
. : . : . : . : . : . :
JMSF044L22+ TTTGTGAACCTTCCGGGACACAAACACTAGTATTGCTGGAATTTCTGTTAAAACACCGCG
JMSF027O18+ TTTGTG-ACCTTCCGGGACACAAACACTAGTANTGCTGGAATTTCTGTTAAAACACCGCG
JMSF025G11+ TCCGGGACACAAACACTAGTATTGCTGGAATTTCTGTTAAAACACCGCG
                      ____________________________________________________________
consensus TTTGTGAACCTTCCGGGACACAAACACTAGTATTGCTGGAATTTCTGTTAAAACACCGCG
 
. : . : . : . : . : . :
JMSF044L22+ TCGGATACGAAACCCGATTGCAGTGCCAAGACTGTAACAACGCAAAATCTTGCTATGGAA
JMSF027O18+ TCGGATACGAAACCCGATTGCAGTGCCAAGACTGTAACAACGCAAAATCTTGCTATGGAA
JMSF025G11+ TCGGATACGAAACCCGATTGCAGTGCCAAGACTGTAACAACGCAAAATCTTGCTATGGAA
                      ____________________________________________________________
consensus TCGGATACGAAACCCGATTGCAGTGCCAAGACTGTAACAACGCAAAATCTTGCTATGGAA
 
. : . : . : . : . : . :
JMSF044L22+ AGCCCTTATAGTCATCAAGTCAAGCAAAGTTCTTGCTCGCTGCCCTTCTGGTAATCTGTC
JMSF027O18+ AGCCCTTATAGTCATCAAGTCAAGCAAAGTTCTTGCTCGCTGCCCTTCTGGTAATCTGTC
JMSF025G11+ AGCCCTTATAGTCATCAAGTCAAGCAAAGTTCTTGCTCGCTGCCCTTCTGGTAATCTGTC
                      ____________________________________________________________
consensus AGCCCTTATAGTCATCAAGTCAAGCAAAGTTCTTGCTCGCTGCCCTTCTGGTAATCTGTC
 
. : . : . : . : . : . :
JMSF044L22+ TTGAGTTTCTGGTTGAACCTCTTTTTGCAGATTTGCAAAATAATTTGCCCTCTCTTCTGC
JMSF027O18+ TTGAGTTTCTGGTTGAACCTCTTTTTGCAGATTTGCAAAATAATTTGCCCTCTCTTCTGC
JMSF025G11+ TTGAGTTTCTGGTTGAACCTCTTTTTGCAGATTTGCAAAATAATTTGCCCTCTCTTCTGC
                      ____________________________________________________________
consensus TTGAGTTTCTGGTTGAACCTCTTTTTGCAGATTTGCAAAATAATTTGCCCTCTCTTCTGC
 
. : . : . : . : . : . :
JMSF044L22+ ATCATCATTTAATCGACTGGGCCAAGAGAAGTATGCAGCATTACTCTCAGAGTGTTGTCC
JMSF027O18+ ATCATCATTTAATCGACTGGGCCAAGAGAAGTATGCAGCATTACTCTCAGAGTGTTGTCC
JMSF025G11+ ATCATCATTTAATCGACTGGGCCAAGAGAAGTATGCAGCATTACTCTCAGAGTGTTGTCC
                      ____________________________________________________________
consensus ATCATCATTTAATCGACTGGGCCAAGAGAAGTATGCAGCATTACTCTCAGAGTGTTGTCC
 
. : . : . : . : . : . :
JMSF044L22+ GGCCGATGCATAAGGTTGGAGTGTTGGTGGACTAAATGAAGGCAAATTGGAATGACTGCA
JMSF027O18+ GGCCGATGCATAAGGTTGGAGTGTTGGTGGACTAAATGAAGGCAAATTGGAATGACTGCA
JMSF025G11+ GGCCGATGCATAAGGTTGGAGTGTTGGTGGACTAAATGAAGGCAAATTGGAATGACTGCA
                      ____________________________________________________________
consensus GGCCGATGCATAAGGTTGGAGTGTTGGTGGACTAAATGAAGGCAAATTGGAATGACTGCA
 
. : . : . : . : . : . :
JMSF044L22+ GCCATATTTTTCAAGGTCCAAAGCTGATTCCTCAGATGGTGTTGAGCCTGAGAAACGGGG
JMSF027O18+ GCCATATTTTTCAAGGTCCAAAGCTGATTCCTCAGATGGTGTTGAGCCTGAGAAACGGGG
JMSF025G11+ GCCATATTTTTCAAGGTCCAAAGCTGATTCCTCAGATGGTGTTGAGCCTGAGAAACGGGG
                      ____________________________________________________________
consensus GCCATATTTTTCAAGGTCCAAAGCTGATTCCTCAGATGGTGTTGAGCCTGAGAAACGGGG
 
. : . : . : . : . : . :
JMSF044L22+ CCTCATATTTGATCTTGCTCTATCCATCTTCTCACATAGCTACAATGGTGTTGGTTGAAT
JMSF027O18+ CCTCATATTTGATCTTGCTCTATCCATCTTCTCACATAGCTACAATGGTGTTGGTTGAAT
JMSF025G11+ CCTCATATTTGATCTTGCTCTATCCATCTTCTCACATAGCTACAATGGTGTTGGTTGAAT
                      ____________________________________________________________
consensus CCTCATATTTGATCTTGCTCTATCCATCTTCTCACATAGCTACAATGGTGTTGGTTGAAT
 
. : . : . : . : . : . :
JMSF044L22+ TGGAACTTCAGACCAAGGGTCACAAGAAAAGCAGTTTTCCGGCGAATCTGAAGAACCCAG
JMSF027O18+ TGGAACTTCAGACCAAGGGTCACAAGAAAAGCAGTTTTCCGGCGAATCTGAAGAACCCAG
JMSF025G11+ TGGAACTTCAGACCAAGGGTCACAAGAAAAGCAGTTTTCCGGCGAATCTGAAGAACCCAG
                      ____________________________________________________________
consensus TGGAACTTCAGACCAAGGGTCACAAGAAAAGCAGTTTTCCGGCGAATCTGAAGAACCCAG
 
. : . : . : . : . : . :
JMSF044L22+ AAGAGTTGGATGTCTGGCCGGCGATGGAGTCTGGACAAGCTTTCCTGGAAAAAGTCAGTG
JMSF027O18+ AAGAGTTGGATGTCTGGCCGGCGATGGAGTCTGGACAAGCTTTCCTGGAAAAAGTCAGTG
JMSF025G11+ AAGAGTTGGATGTCTGGCCGGCGATGGAGTCTGGACAAGCTTTCCTGGAAAAAGTCAGTG
                      ____________________________________________________________
consensus AAGAGTTGGATGTCTGGCCGGCGATGGAGTCTGGACAAGCTTTCCTGGAAAAAGTCAGTG
 
. : . : . : . : . : . :
JMSF044L22+ GACGGGACGGGGAGAGCAGAAGAGGTTTGCAGAGTTCGATTACTCAATT
JMSF027O18+ GACGGGACGGGGAGAGCAGAAGAGGTTTGCAGAGTTCGATTACTCAATTATTTCGCCC
JMSF025G11+ GACGGGACGGGGAGAGCAGAAGAGGTTTGCAGAGTTCGATTACTCAATTATTTCGCCCCC
                      ____________________________________________________________
consensus GACGGGACGGGGAGAGCAGAAGAGGTTTGCAGAGTTCGATTACTCAATTATTTCGCCCCC