Previous Contig 006291:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016H22Sequence331006291 (2)
JMSF025G10Sequence653006291 (2)483023168

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF016H22+ AAAACAATTTAGTACGATAAAAACTAGAATGAAACTATTTTTATGNAGAAAGTG
                      ____________________________________________________________
consensus AAAACAATTTAGTACGATAAAAACTAGAATGAAACTATTTTTATGNAGAAAGTG
 
. : . : . : . : . : . :
JMSF016H22+ NGTATATATNGACAAACCGTATCGGAGTTGAAAATGTCATCAACAAAANTGNGAATAGAA
JMSF025G10+ CGTATCGGAGTNGAAAATGTCATCAACAAAATTGAGAATAGAA
                      ____________________________________________________________
consensus NGTATATATNGACAAACCGTATCGGAGTTGAAAATGTCATCAACAAAATTGAGAATAGAA
 
. : . : . : . : . : . :
JMSF016H22+ CTTGTATCGACATCCATTATTTCACCTCTGGGNTCATGTGTAGCCTTAACATGTTCCATG
JMSF025G10+ CTTGTATCGACATCCATTATTTCACCTCTGGGATCATGTGTAGCCTTAACATGTTCCATG
                      ____________________________________________________________
consensus CTTGTATCGACATCCATTATTTCACCTCTGGGATCATGTGTAGCCTTAACATGTTCCATG
 
. : . : . : . : . : . :
JMSF016H22+ ATAATCGCGTCCTCAGTATCAATGGCATGGTTNTGTGAAACCATTGNCGTTGATAGAGAT
JMSF025G10+ ATAATCGCGTCCTCAGTATCAATGGCATGGTTTTGTGAAACCATTGTCGTTGATAGAGAT
                      ____________________________________________________________
consensus ATAATCGCGTCCTCAGTATCAATGGCATGGTTTTGTGAAACCATTGTCGTTGATAGAGAT
 
. : . : . : . : . : . :
JMSF016H22+ AGAACTNGGTTCGACATGTGTAATAGATATGAAGAAGAGAATATTAATTCCTTGCTTGGA
JMSF025G10+ AGAACTTGGTTTGACATGTGTAATAGATATGAAGAAGAGAATATTAATTCCTTGCTTGGA
                      ____________________________________________________________
consensus AGAACTTGGTTTGACATGTGTAATAGATATGAAGAAGAGAATATTAATTCCTTGCTTGGA
 
. : . : . : . : . : . :
JMSF016H22+ TNGCTNTTGANTATAATAATCNTGAATTTTGTT
JMSF025G10+ TTGCTTTTGATTATAATAATCTTGAATTTTGTTTTCAAGGATTGTGTTCATTTAGGTCTT
                      ____________________________________________________________
consensus TTGCTTTTGATTATAATAATCTTGAATTTTGTTTTCAAGGATTGTGTTCATTTAGGTCTT
 
. : . : . : . : . : . :
JMSF025G10+ GTATATATAGTATATGAATTGATGATCTCTTGTAGAAGAGCTAACTTCAATACCTAGCTT
                      ____________________________________________________________
consensus GTATATATAGTATATGAATTGATGATCTCTTGTAGAAGAGCTAACTTCAATACCTAGCTT
 
. : . : . : . : . : . :
JMSF025G10+ CGAGATAAGGTAATCATCAAGAGAATCAAAATGAAAAACGTACTCTTCAAGTATCTTAAT
                      ____________________________________________________________
consensus CGAGATAAGGTAATCATCAAGAGAATCAAAATGAAAAACGTACTCTTCAAGTATCTTAAT
 
. : . : . : . : . : . :
JMSF025G10+ GCTTTAAAAAAGAAGAAAAGAAAAAGGTTTCTACGTACGTACGTAGATGATATGTGCTGC
                      ____________________________________________________________
consensus GCTTTAAAAAAGAAGAAAAGAAAAAGGTTTCTACGTACGTACGTAGATGATATGTGCTGC
 
. : . : . : . : . : . :
JMSF025G10+ CAGGAATAACTATGGTATATTGCATAAAGATATATACTGATGATTATTGCCAATGACCTT
                      ____________________________________________________________
consensus CAGGAATAACTATGGTATATTGCATAAAGATATATACTGATGATTATTGCCAATGACCTT
 
. : . : . : . : . : . :
JMSF025G10+ GTGGTCTAATTAAGTCACTGCTGGAAATTATAGAATTTCCGACCACGTGGAAGTGATCTT
                      ____________________________________________________________
consensus GTGGTCTAATTAAGTCACTGCTGGAAATTATAGAATTTCCGACCACGTGGAAGTGATCTT
 
. : . : . : . : . : . :
JMSF025G10+ AAATCAAGTCGAAAGCAAAAAGTGGTCGGAAATCGCAATAAAGGTTTTTCCGAATACCAA
                      ____________________________________________________________
consensus AAATCAAGTCGAAAGCAAAAAGTGGTCGGAAATCGCAATAAAGGTTTTTCCGAATACCAA