Previous Contig 006275:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025C20Sequence664006275 (3)gb:PVU77935_17030601e-28Phaseolus vulgaris DnaJ-like protein mRNA, partial cds.603006275 (3)gb:PVU77935_17030601e-28Phaseolus vulgaris DnaJ-like protein mRNA, partial cds.
JMSF027C20Sequence138002940 (2)372006275 (3)gb:PVU77935_17030603e-16Phaseolus vulgaris DnaJ-like protein mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025C20+ GATC
JMSF025C20- GATC
                      ____________________________________________________________
consensus GATC
 
. : . : . : . : . : . :
rJMSF025C20+ CATAATCTCATTTTTCCACAAAGAATCAACCTGAAATCATTCATGGCTTCTGCGTCAATT
JMSF025C20- CATAATCTCATTTTTCCACAAAGAATCAACCTGAAATCATTCATGGCTTCTGCGTCAATT
                      ____________________________________________________________
consensus CATAATCTCATTTTTCCACAAAGAATCAACCTGAAATCATTCATGGCTTCTGCGTCAATT
 
. : . : . : . : . : . :
rJMSF025C20+ CCTTTCTGTTCCCAATTTTCCGGCACCGGAGTTTCCTCGGCGCGATCGCGGCGGAGCGGT
rJMSF027C20+ TTCTGTTCCCAATTTTCCGGCACCGGAGTTTCCTCGGCNCGATCGCGGCGGAGCGGT
JMSF025C20- CCTTTCTGTTCCCAATTTTCCGGCACCGGAGTTTCCTCGGCGCGATCGCGGCGGAGCGGT
                      ____________________________________________________________
consensus CCTTTCTGTTCCCAATTTTCCGGCACCGGAGTTTCCTCGGCGCGATCGCGGCGGAGCGGT
 
. : . : . : . : . : . :
rJMSF025C20+ GTGGCGTTCCGTCAGCCGATTTCCACCGTCTCCGCCTCCTGTGCTACGGCGGAGCGGACC
rJMSF027C20+ GNNNCGTTCCGTCAGCCGATTTNCACNGTCTCCGCCTCCNGTGCTACGGCGGAGCGGACC
JMSF025C20- GTGGCGTTCCGTCAGCCGATTTCCACCGTCTCCGCCTCCTGTGCTACGGCGGAGCGGACC
                      ____________________________________________________________
consensus GTGGCGTTCCGTCAGCCGATTTCCACCGTCTCCGCCTCCTGTGCTACGGCGGAGCGGACC
 
. : . : . : . : . : . :
rJMSF025C20+ AGCAGCGGCGCCGCCACGCACGCCTCGCTCTACGAAGTTCTCGGGATTCAGACGGGCGCC
rJMSF027C20+ AGCAGCGGNGCCGCCACGCACGCCTCGCTGTACGAAGTTCTCGGGATTCAGACGGGCGCC
JMSF025C20- AGCAGCGGCGCCGCCACGCACGCCTCGCTCTACGAAGTTCTCGGGATTCAGACGGGCGCC
                      ____________________________________________________________
consensus AGCAGCGGCGCCGCCACGCACGCCTCGCTCTACGAAGTTCTCGGGATTCAGACGGGCGCC
 
. : . : . : . : . : . :
rJMSF025C20+ ACGTGTCAGGAAATCAAGGCTGCATACAGGAGGCTGGCTAGGGTTTTGCATCCGGACGTC
rJMSF027C20+ ACGTGTCAGGAAATCAAGGCTGCATACAGGAGGCTGGCTAGGGTTTTGCATCCGGACGTC
JMSF025C20- ACGTGTCAGGAAATCAAGGCTGCATACAGGAGGCTGGCTAGGGTTTTGCATCCGGACGTC
                      ____________________________________________________________
consensus ACGTGTCAGGAAATCAAGGCTGCATACAGGAGGCTGGCTAGGGTTTTGCATCCGGACGTC
 
. : . : . : . : . : . :
rJMSF025C20+ GCGTCTAGCTTTCGCCGGGAATCGTCGGACGAAGACTTCATCAGAGTGCACGCGGCGTAC
rJMSF027C20+ GCGTCTAGCCNTCGCCGGGAATCGTCGGACGAAGACTTCATCAGAGTNCACGCGGNGTAN
JMSF025C20- GCGTCTAGCTTTCGCCGGGAATCGTCGGACGAAGACTTCATCAGAGTGCACGCGGCGTAC
                      ____________________________________________________________
consensus GCGTCTAGCTTTCGCCGGGAATCGTCGGACGAAGACTTCATCAGAGTGCACGCGGCGTAC
 
. : . : . : . : . : . :
rJMSF025C20+ GTCACTCTCTCCGATCCACAAAAGCGTGCGAATTACGACCGGACTCTGTTCCGGCCGGGG
rJMSF027C20+ GTCACTCTCTNCGATCCACAAAAGCGTGAGAATTACGACCGGNCTCTGNTCCGNCCGGGG
JMSF025C20- GTCACTCTCTCCGATCCACAAAAGCGTGCGAATTACGACCGGACTCTGTTCCGGCCGGGG
                      ____________________________________________________________
consensus GTCACTCTCTCCGATCCACAAAAGCGTGCGAATTACGACCGGACTCTGTTCCGGCCGGGG
 
. : . : . : . : . : . :
rJMSF025C20+ CAGAGCAGGCCGCCGGTTGTGTTTTCTGGTGTTAACAGTCGCCGGAATTGGGAAACTGAT
rJMSF027C20+ CAGANCAGGCC
JMSF025C20- CAGAGCAGGCCGCCGGTTGTGTTTTCTGGTGTTAACAGTCGCCGGAATTGGGAAACTGAT
                      ____________________________________________________________
consensus CAGAGCAGGCCGCCGGTTGTGTTTTCTGGTGTTAACAGTCGCCGGAATTGGGAAACTGAT
 
. : . : . : . : . : . :
rJMSF025C20+ CAATGCTGGTAGCTGAAGGGAGTGATAATCACATATTAGGCTTAATTCTTTGATTTTATG
JMSF025C20- CAATGCTGGTAGCTGAAGGGAGTGATAATCACATATTAGGCTTAATTCTTTGATTTTATG
                      ____________________________________________________________
consensus CAATGCTGGTAGCTGAAGGGAGTGATAATCACATATTAGGCTTAATTCTTTGATTTTATG
 
. : . : . : . : . : . :
rJMSF025C20+ AGCAGGTTACCTTTAATCTCGCTATAACTTCATTGACGACAAGTTTGAAACTCAAAATT
JMSF025C20- AGCAGGTTACCTTTAATCTCGCTATAACTTCATTGACGACAAGTTTGAAACTCAAAATTT
                      ____________________________________________________________
consensus AGCAGGTTACCTTTAATCTCGCTATAACTTCATTGACGACAAGTTTGAAACTCAAAATTT
 
. : . : . : . : . : . :
JMSF025C20- TGCTGTAAATCCTAAGTTTTCATGAGTTTAAGTCTGAATATTCATTAATGTGCAAAAAAA
                      ____________________________________________________________
consensus TGCTGTAAATCCTAAGTTTTCATGAGTTTAAGTCTGAATATTCATTAATGTGCAAAAAAA