Previous Contig 006274:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS004G06Sequence424006274 (3)gb:BT004635_16376692e-28Arabidopsis thaliana At4g02100 gene, complete cds.
JMSF025C08Sequence674006274 (3)pir|T00440|T004407e-49hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153805012393 (2)pir|T00440|T004409e-58hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153
JMSF036K03Sequence681006274 (3)pir|T00440|T004401e-50hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153716012393 (2)pir|T00440|T004404e-47hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036K03+ CATTAGCCCCAAATGGCAACACG
JMSF025C08+ CAAATGGCAACACG
                      ____________________________________________________________
consensus CATTAGCCCCAAATGGCAACACG
 
. : . : . : . : . : . :
JMSF036K03+ CTTGACCTAATACCAAATATCTCCATAGACCGTCCTTTTCGCAGCTTTTGCAGAGCCCAG
JMSF025C08+ CTTGACCTAATACCAAATATCTCCATAGACCGTCCTTTTCGCAGCTTTTGCAGAGCCCAG
                      ____________________________________________________________
consensus CTTGACCTAATACCAAATATCTCCATAGACCGTCCTTTTCGCAGCTTTTGCAGAGCCCAG
 
. : . : . : . : . : . :
JMSF036K03+ CCATGACCTTCTTCTTCAAATCGGAGACCGAGAAACACTTGAAAGTGGGCTCGTCATCCC
JMSF025C08+ CCATGACCTTCTTCTTCAAATCGGAGACCGAGAAACACTTGAAAGTGGGCTCGTCATCCC
                      ____________________________________________________________
consensus CCATGACCTTCTTCTTCAAATCGGAGACCGAGAAACACTTGAAAGTGGGCTCGTCATCCC
 
. : . : . : . : . : . :
JMSF036K03+ CGGAGGAGAGAAGCTTCACACGCTCCCTAGACAGCGGCCTGGAGGAGCCATCCGACGATT
JMSF025C08+ CGGAGGAGAGAAGCTTCACACGCTCCCTAGACAGCGGCCTGGAGGAGCCATCCGACGATT
                      ____________________________________________________________
consensus CGGAGGAGAGAAGCTTCACACGCTCCCTAGACAGCGGCCTGGAGGAGCCATCCGACGATT
 
. : . : . : . : . : . :
JMSF036K03+ CAGAAGAAGACGAACACGGCGACGCTTCATCCGGGGCTACTTTAAGACTGGGAATGTAGT
JMFS004G06+ TTTAAGACTGGGAATGTAGT
JMSF025C08+ CAGAAGAAGACGAACACGGCGACGCTTCATCCGGGGCTACTTTAAGACTGGGAATGTAGT
                      ____________________________________________________________
consensus CAGAAGAAGACGAACACGGCGACGCTTCATCCGGGGCTACTTTAAGACTGGGAATGTAGT
 
. : . : . : . : . : . :
JMSF036K03+ CCTGCAACATATCGGCGACGTCCTTAAACCGCCGGAGAAAAAGCAAAGTCCGCGCCTTTA
JMFS004G06+ CCTGCAACATATCGGCGACGTCCTTAAACCGCCGGAGAAAAAGCAAAGTCCGCGCCTTTA
JMSF025C08+ CCTGCAACATATCGGCGACGTCCTTAAACCGCCGGAGAAAAAGCAAAGTCCGCGCCTTTA
                      ____________________________________________________________
consensus CCTGCAACATATCGGCGACGTCCTTAAACCGCCGGAGAAAAAGCAAAGTCCGCGCCTTTA
 
. : . : . : . : . : . :
JMSF036K03+ ACTCCATGGCCAACTCGAGTCGAGGCGAGAGAAGCAGCGCGGCATCAAGAACGTTCAGAG
JMFS004G06+ ACTCCATGGCCAACTCGAGTCGAGGCGAGAGAAGCAGCGCGGCATCAAGAACGTTCAGAG
JMSF025C08+ ACTCCATGGCCAACTCGAGTCGAGGCGAGAGAAGCAGCGCGGCATCAAGAACGTTCAGAG
                      ____________________________________________________________
consensus ACTCCATGGCCAACTCGAGTCGAGGCGAGAGAAGCAGCGCGGCATCAAGAACGTTCAGAG
 
. : . : . : . : . : . :
JMSF036K03+ CAGAAGCCATGGCGCCGGGGTCTTGACTTGCAATCAGAACTTTCGCATCCTTCACATATT
JMFS004G06+ CAGAAGCCATGGCGCCGGGGTCTTGACTTGCAATCAGAACTTTCGCATCCTTCACATATT
JMSF025C08+ CAGAAGCCATGGCGCCGGGGTCTTGACTTGCAATCAGAACTTTCGCATCCTTCACATATT
                      ____________________________________________________________
consensus CAGAAGCCATGGCGCCGGGGTCTTGACTTGCAATCAGAACTTTCGCATCCTTCACATATT
 
. : . : . : . : . : . :
JMSF036K03+ TATCGGCAATCTTCCTGTTTGTAAGCCACCAATGCTGCTTCTTCTCACCGCCGGCGAAAC
JMFS004G06+ TATCGGCAATCTTCCTGTTTGTAAGCCACCAATGCTGCTTCTTCTCACCGCCGGCGAAAC
JMSF025C08+ TATCGGCAATCTTCCTGTTTGTAAGCCACCAATGCTGCTTCTTCTCACCGCCGGCGAAAC
                      ____________________________________________________________
consensus TATCGGCAATCTTCCTGTTTGTAAGCCACCAATGCTGCTTCTTCTCACCGCCGGCGAAAC
 
. : . : . : . : . : . :
JMSF036K03+ AGGGAGATTCAGACATCGTTGTTCCGAGTTCTGA--GAATGACTGACTATGTTGCGCGAG
JMFS004G06+ AGGGAGATTCAGACATCGTTGTTCCGAGTTCTGACTGAATGACTGACTATGTTGCGCGAG
JMSF025C08+ AGGGAGATTCAGACATCGTTGTTCCGAGTTCTGACTGAATGACTGACTATGTTGCGCGAG
                      ____________________________________________________________
consensus AGGGAGATTCAGACATCGTTGTTCCGAGTTCTGACTGAATGACTGACTATGTTGCGCGAG
 
. : . : . : . : . : . :
JMSF036K03+ TATTAATTAATCCTTAAAAGCTCCACAGTCATTCTTAAACTTGATCCCAGTTTGTGGGTG
JMFS004G06+ TATTAATTAATCCTTAAAAGCTCCACAGTCATTCTTAAACTTGATCCCAGTTTGTGGGTG
JMSF025C08+ TATTAATTAATCCTTAAAAGCTCCACAGTCATTCTTAAACTTGATCCCAGTTTGTGGGTG
                      ____________________________________________________________
consensus TATTAATTAATCCTTAAAAGCTCCACAGTCATTCTTAAACTTGATCCCAGTTTGTGGGTG
 
. : . : . : . : . : . :
JMSF036K03+ ATGGGGAGAGAAGAACAGAGAGGTAGAAGACTAAATAAGAGGCACAGGGAAGAGGCCAGC
JMFS004G06+ ATGGGGAGAGAAGAACAGAGAGGTAGAAGACTAAATAAGAGGCA
JMSF025C08+ ATGGGGAGAGAAGAACAGAGAGGTAGAAGACTAAATAAGAGGCACAGGGAAGAGGCCAGC
                      ____________________________________________________________
consensus ATGGGGAGAGAAGAACAGAGAGGTAGAAGACTAAATAAGAGGCACAGGGAAGAGGCCAGC