Previous Contig 006273:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050P06Sequence630006273 (3)gb:SOL427913_17158051e-07Spinacia oleracea partial mRNA for sigma factor (sig3 gene).591011042 (3)gb:AB004822_15091926e-37Arabidopsis thaliana SIG3 mRNA for plastid RNA polymerase sigma-subunit, complet
JMSF025B24Sequence604006273 (3)gb:SOL427913_17158051e-07Spinacia oleracea partial mRNA for sigma factor (sig3 gene).734011042 (3)gb:AB004822_15091922e-59Arabidopsis thaliana SIG3 mRNA for plastid RNA polymerase sigma-subunit, complet
JMSF044G16Sequence797006273 (3)gb:SOL427913_17158052e-07Spinacia oleracea partial mRNA for sigma factor (sig3 gene).723011042 (3)gb:AB004822_15091922e-49Arabidopsis thaliana SIG3 mRNA for plastid RNA polymerase sigma-subunit, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044G16+ CTTCACTGCTAGCAATTTTCTCTCTAGTATTTCTAAAATTTCGCCATGTTTTTCC
                      ____________________________________________________________
consensus CTTCACTGCTAGCAATTTTCTCTCTAGTATTTCTAAAATTTCGCCATGTTTTTCC
 
. : . : . : . : . : . :
JMSF044G16+ AGAAGAAATATTTGGGTATTTTGACTCCAATTTGGATGTTTTTGGCTGCAGATGTAGTGT
                      ____________________________________________________________
consensus AGAAGAAATATTTGGGTATTTTGACTCCAATTTGGATGTTTTTGGCTGCAGATGTAGTGT
 
. : . : . : . : . : . :
JMSF044G16+ AAAAACATCACTATTAGTATCGGACCGTTTCCTTCTTCTCAACTCTCTTTCCTGCTTTTT
                      ____________________________________________________________
consensus AAAAACATCACTATTAGTATCGGACCGTTTCCTTCTTCTCAACTCTCTTTCCTGCTTTTT
 
. : . : . : . : . : . :
JMSF044G16+ CCCCGAGGTAACAACGATCTTATTCATGTGAATATTCAGGAGGTCGTTCTCCTGAGTTTC
JMFF050P06+ GAATATTCAGGAGGTCGTTCTCCTGAGTTTC
JMSF025B24+ TTTC
                      ____________________________________________________________
consensus CCCCGAGGTAACAACGATCTTATTCATGTGAATATTCAGGAGGTCGTTCTCCTGAGTTTC
 
. : . : . : . : . : . :
JMSF044G16+ GTGAACAAGCTCAGTTGGCCTGTTTGTCAAATCAGAAAAGGGAAAAGATTTTTGACCCCT
JMFF050P06+ GTGAACAAGCTCAGTTGGCCTGTTTGTCAAATCAGAAAAGGGAAAAGATTTTTGACCCCT
JMSF025B24+ GTGAACAAGCTCAGTTGGCCTGTTTGTCAAATCAGAAAAGGGAAAAGATTTTTGACCCCT
                      ____________________________________________________________
consensus GTGAACAAGCTCAGTTGGCCTGTTTGTCAAATCAGAAAAGGGAAAAGATTTTTGACCCCT
 
. : . : . : . : . : . :
JMSF044G16+ CGAGAGAAAAGTATTGAATAATTCCAGAGCTCCGAGCCTCTCAAGTTGTGCCAGAATATC
JMFF050P06+ CGAGAGAAAAGTATTGAATAATTCCAGAGCTCCGAGCCTCTCAAGTTGTGCCAGAATATC
JMSF025B24+ CGAGAGAAAAGTATTGAATAATTCCAGAGCTCCGAGCCTCTCAAGTTGTGCCAGAATATC
                      ____________________________________________________________
consensus CGAGAGAAAAGTATTGAATAATTCCAGAGCTCCGAGCCTCTCAAGTTGTGCCAGAATATC
 
. : . : . : . : . : . :
JMSF044G16+ TCTTTCAAGTCCAACCACACATGAATCGGCAAAAATGTTTTCCAAAAGATCAAGATTTTT
JMFF050P06+ TCTTTCAAGTCCAACCACACATGAATCGGCAAAAATGTTTTCCAAAAGATCAAGATTTTT
JMSF025B24+ TCTTTCAAGTCCAACCACACATGAATCGGCAAAAATGTTTTCCAAAAGATCAAGATTTTT
                      ____________________________________________________________
consensus TCTTTCAAGTCCAACCACACATGAATCGGCAAAAATGTTTTCCAAAAGATCAAGATTTTT
 
. : . : . : . : . : . :
JMSF044G16+ CATAAGTAAACTAAACTGTTTTCCTTTGCTTGATTTAAGGAATTTTAATTTGTCCTCCTC
JMFF050P06+ CATAAGTAAACTAAACTGTTTTCCTTTGCTTGATTTAAGGAATTTTAATTTGTCCTCCTC
JMSF025B24+ CATAAGTAAACTAAACTGTTTTCCTTTGCTTGATTTAAGGAATTTTAATTTGTCCTCCTC
                      ____________________________________________________________
consensus CATAAGTAAACTAAACTGTTTTCCTTTGCTTGATTTAAGGAATTTTAATTTGTCCTCCTC
 
. : . : . : . : . : . :
JMSF044G16+ GGTTAACACCTCCCTGTTGTTTCCGATCACATCGTATAAGCTACTGTGAGATCCTACGCC
JMFF050P06+ GGTTAACACCTCCCTGTTGTTTCCGATCACATCGTATAAGCTACTGTGAGATCCTACGCC
JMSF025B24+ GGTTAACACCTCCCTGTTGTTTCCGATCACATCGTATAAGCTACTGTGAGATCCTACGCC
                      ____________________________________________________________
consensus GGTTAACACCTCCCTGTTGTTTCCGATCACATCGTATAAGCTACTGTGAGATCCTACGCC
 
. : . : . : . : . : . :
JMSF044G16+ AATTTCCATTTCTGCAGTTACTGAGATTTCATTTTCCCGGAGCTGTCGGTCAGATAAACA
JMFF050P06+ AATTTCCATTTCTGCAGTTACTGAGATTTCATTTTCCCGGAGCTGTCGGTCAGATAAACA
JMSF025B24+ AATTTCCATTTCTGCAGTTACTGAGATTTCATTTTCCCGGAGCTGTCGGTCAGATAAACA
                      ____________________________________________________________
consensus AATTTCCATTTCTGCAGTTACTGAGATTTCATTTTCCCGGAGCTGTCGGTCAGATAAACA
 
. : . : . : . : . : . :
JMSF044G16+ AGTCCTCACTCTGAAAGGATCAGTATGTGAAGCTTCATTCTCCCAGTGCATAAAAGACGG
JMFF050P06+ AGTCCTCACTCTGAAAGGATCAGTATGTGAAGCTTCATTCTCCCAGTGCATAAAAGACGG
JMSF025B24+ AGTCCTCACTCTGAAAGGATCAGTATGTGAAGCTTCATTCTCCCAGTGCATAAAAGACGG
                      ____________________________________________________________
consensus AGTCCTCACTCTGAAAGGATCAGTATGTGAAGCTTCATTCTCCCAGTGCATAAAAGACGG
 
. : . : . : . : . : . :
JMSF044G16+ AGAAGTTCCAACCGAGTCATATAAAATCTCCCTTCCCTTTAATGAAGTTGAAGAAGGCCA
JMFF050P06+ AGAAGTTCCAACCGAGTCATATAAAATCTCCCTTCCCTTTAATGAAGTTGAAGAAGGCCA
JMSF025B24+ AGAAGTTCCAACCGAGTCATATAAAATCTCCCTTCCCTTTAATGAAGTTGAAGAAGGCCA
                      ____________________________________________________________
consensus AGAAGTTCCAACCGAGTCATATAAAATCTCCCTTCCCTTTAATGAAGTTGAAGAAGGCCA
 
. : . : . : . : . : . :
JMSF044G16+ AGAAGATGATGATCTGAAAGAGAAAATTTGAGGGTGAGTTGAGAGACCCCATCTCAGGTG
JMFF050P06+ AGAAGATGATGATCTGAAAGAGAAAATTTGAGGGTGAGTTGAGAGACCCCATCTCAGGTG
JMSF025B24+ AGAAGATGATGATCTGAAAGAGAAAATTTGAGGGTGAGTTGAGAGACCCCATCTCAGGTG
                      ____________________________________________________________
consensus AGAAGATGATGATCTGAAAGAGAAAATTTGAGGGTGAGTTGAGAGACCCCATCTCAGGTG
 
. : . : . : . : . : . :
JMSF044G16+ CAGCCTAAAACCCATATC
JMFF050P06+ CAGCCTAAAACCCATATCCACAGAGTTTGTTCAGAGAGGAGCAGAAGAAAAGTGCCCAT
JMSF025B24+ CAGCCTAAAACCCATATCCACAGAGTTTGTTCAGAGAGGAGCAGAAGAAAAGTGCCCATC
                      ____________________________________________________________
consensus CAGCCTAAAACCCATATCCACAGAGTTTGTTCAGAGAGGAGCAGAAGAAAAGTGCCCATC