Previous Contig 006271:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019M02Sequence496006271 (10)gb:AY084529_15696188e-22Arabidopsis thaliana clone 11084 mRNA, complete sequence.766006271 (10)gb:AY084529_15696181e-36Arabidopsis thaliana clone 11084 mRNA, complete sequence.
JMFN013P12Sequence620006271 (10)gb:AY084529_15696182e-35Arabidopsis thaliana clone 11084 mRNA, complete sequence.
JMSF009M16Sequence257006271 (10)697006271 (10)gb:AY084529_15696188e-37Arabidopsis thaliana clone 11084 mRNA, complete sequence.
JMSF013J08Sequence187006271 (10)684006271 (10)gb:AY084529_15696188e-37Arabidopsis thaliana clone 11084 mRNA, complete sequence.
JMSF025A06Sequence699006271 (10)gb:AY084529_15696188e-37Arabidopsis thaliana clone 11084 mRNA, complete sequence.
JMSF025B08Sequence666006271 (10)gb:AY084529_15696183e-16Arabidopsis thaliana clone 11084 mRNA, complete sequence.715023153gb:AY084529_15696182e-13Arabidopsis thaliana clone 11084 mRNA, complete sequence.
JMSF032H18Sequence708006271 (10)gb:AY084529_15696189e-37Arabidopsis thaliana clone 11084 mRNA, complete sequence.589005510 (67)pir|T52334|T523341e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN013P12- CGAGGGAGAGAACTAGTCCTGAGXXXXXXXXXXXXXXXXXXXXGGCAAA
rJMFF019M02- GGCAAA
                      ____________________________________________________________
consensus CGAGGGAGAGAACTAGTCCTGAGNNNNNNNNNNNNNNNNNNNNGGCAAA
 
. : . : . : . : . : . :
JMFN013P12- GAAGAACAAAATTTGTGTACTTTCTGAAGAAAAAGGAATTGATAGTGTTTATACATTGAA
rJMFF019M02- GAAGAACAAAATTTGTGTACTTTCTGAAGAAAAAGGAATTGATAGTGTTTATACATTGAA
JMSF025A06+ CTGAAGAAAAAGGAATTGATAGTGTTTATACATTGAA
rJMSF013J08- ATTGATAGTGTTTATACATTGAA
JMSF032H18+ CTGAAGAAAAAGGAATTGATAGTGTTTATACATTGAA
rJMSF009M16- ATTGATAGTGTTTATACATTGAA
                      ____________________________________________________________
consensus GAAGAACAAAATTTGTGTACTTTCTGAAGAAAAAGGAATTGATAGTGTTTATACATTGAA
 
. : . : . : . : . : . :
JMFN013P12- CAAGCACATAAAAATGGATGACTAAAAGAAAAAAGATTACATGAAAATTTGGATATTACA
rJMFF019M02- CAAGCACATAAAAATGGATGACTAAAAGAAAAAAGATTACATGAAATATTGGATATTACA
JMSF025A06+ CAAGCACATAAAAATGGATGACTAAAAGAAAAAAGATTACATGAAATATTGGATATTACA
rJMSF013J08- CAAGCACATAAAAATGGATGACTAAAAGAAAAAAGATTACATGAAATATTGGATATTACA
JMSF032H18+ CAAGCACATAAAAATGGATGACTAAAAGAAAAAAGATTACATGAAATATTGGATATTACA
rJMSF009M16- CAAGCACATAAAAATGGATGACTAAAAGAAAAAAGATTACATGAAATATTGGATATTACA
                      ____________________________________________________________
consensus CAAGCACATAAAAATGGATGACTAAAAGAAAAAAGATTACATGAAATATTGGATATTACA
 
. : . : . : . : . : . :
JMFN013P12- GCAGAAGGTAGAGAGAGTAGGATAGGCTTGATTGATGATAAGCATGGTCTCATTCCAAGT
rJMFF019M02- GCAGAAGGTAGAGAGAGTAGG-TAGGCTTGATTGATGATAAGCATGGTCTCATTCCAAGT
JMSF025A06+ GCAGAAGGTAGAGAGAGTAGG-TAGGCTTGATTGATGATAAGCATGGTCTCATTCCAAGT
rJMSF013J08- GCAGAAGGTAGAGAGAGTAGG-TAGGCTTGATTGATGATAAGCATGGTCTCATTCCAAGT
JMSF032H18+ GCAGAAGGTAGAGAGAGTAGG-TAGGCTTGATTGATGATAAGCATGGTCTCATTCCAAGT
rJMSF009M16- GCAGAAGGTAGAGAGAGTAGG-TAGGCTTGATTGATGATAAGCATGGTCTCATTCCAAGT
                      ____________________________________________________________
consensus GCAGAAGGTAGAGAGAGTAGG-TAGGCTTGATTGATGATAAGCATGGTCTCATTCCAAGT
 
. : . : . : . : . : . :
JMFN013P12- CTAGAATCCCGAAATTCGAAAGTAGAATCTTAACTTGATCAACAAAGTCAGAGCCTGTAG
rJMFF019M02- CTAGAATCCCGAAATTCGAAAGTAGAATCTTAACTTGATCAACAAAGTCAGAGCCTGTAG
JMSF025A06+ CTAGAATCCCGAAATTCGAAAGTAGAATCTTAACTTGATCAACAAAGTCAGAGCCTGTAG
rJMSF013J08- CTAGAATCCCGAAATTCGAAAGTAGAATCTTAACTTGATCAACAAAGTCAGAGCCTGTAG
JMSF032H18+ CTAGAATCCCGAAATTCGAAAGTAGAATCTTAACTTGATCAACAAAGTCAGAGCCTGTAG
rJMSF009M16- CTAGAATCCCGAAATTCGAAAGTAGAATCTTAACTTGATCAACAAAGTCAGAGCCTGTAG
                      ____________________________________________________________
consensus CTAGAATCCCGAAATTCGAAAGTAGAATCTTAACTTGATCAACAAAGTCAGAGCCTGTAG
 
. : . : . : . : . : . :
JMFF019M02+ ATCCCAACAGCAAAACCAAACATCGCCCATCTGCCATTGGCGATTT
JMFN013P12- CGTACTCCGTCAACATCCCAACAGCAAAACCAAACATCGCCCATCTGCCATTGGCGATTT
rJMFF019M02- CGTACTCCGTCAACATCCCAACAGCAAAACCAAACATCGCCCATCTGCCATTGGCGATTT
JMSF025A06+ CGTACTCCGTCAACATCCCAACAGCAAAACCAAACATCGCCCATCTGCCATTGGCGATTT
rJMSF013J08- CGTACTCCGTCAACATCCCAACAGCAAAACCAAACATCGCCCATCTGCCATTGGCGATTT
JMSF032H18+ CGTACTCCGTCAACATCCCAACAGCAAAACCAAACATCGCCCATCTGCCATTGGCGATTT
rJMSF009M16- CGTACTCCGTCAACATCCCAACAGCAAAACCAAACATCGCCCATCTGCCATTGGCGATTT
JMSF025B08+ CTGCCATTGGCGATTT
                      ____________________________________________________________
consensus CGTACTCCGTCAACATCCCAACAGCAAAACCAAACATCGCCCATCTGCCATTGGCGATTT
 
. : . : . : . : . : . :
JMFF019M02+ CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
JMFN013P12- CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
rJMFF019M02- CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
JMSF025A06+ CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
rJMSF013J08- CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
JMSF032H18+ CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
rJMSF009M16- CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
JMSF025B08+ CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
                      ____________________________________________________________
consensus CATTCTTGCCAATAAACCCAAAGAAGGGGCCTTGATTAGCATCGTCTAGCTTCTTCTGTT
 
. : . : . : . : . : . :
JMFF019M02+ TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
JMFN013P12- TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
rJMFF019M02- TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
JMSF025A06+ TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
rJMSF013J08- TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
JMSF032H18+ TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
rJMSF009M16- TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
JMSF025B08+ TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
                      ____________________________________________________________
consensus TGAAGTATTCCTGCAATTCCTTAGCCTTCTGGCGCTGAAACTCCAGGGTAACCACACTCT
 
. : . : . : . : . : . :
JMFF019M02+ TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
JMFN013P12- TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
rJMFF019M02- TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
JMSF025A06+ TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
rJMSF013J08- TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
JMSF032H18+ TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
rJMSF009M16- TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
JMSF009M16+ AG
JMSF025B08+ TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
                      ____________________________________________________________
consensus TGTCCTCAACAGCCGCCGCCTTGGGAGGAGCACTCGGCGGCGGCGGCGGAGAAGCGGAAG
 
. : . : . : . : . : . :
JMFF019M02+ GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
JMFN013P12- GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
rJMFF019M02- GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
JMSF025A06+ GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
rJMSF013J08- GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
JMSF032H18+ GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
rJMSF009M16- GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
JMSF009M16+ GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
JMSF025B08+ GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
                      ____________________________________________________________
consensus GCGGGACCGGCTTTACAGGCGTGGGAGGGGAAGGAGCCACGGGTCTTCTGAAAGGGCCTT
 
. : . : . : . : . : . :
JMFF019M02+ CAGCTTGAGAGTTCCTTA
JMFN013P12- CAGCTTGAGAGTTCCTTATGTTAAGTGCGGG
rJMFF019M02- CAGCTTGAGAGTTCCTTATGTTAAGTGCGGGTGGCTTGGATACACAGAATCTCATAAAAG
JMSF025A06+ CAGCTTGAGAGTTCCTTATGTTAAGTGCGGGTGGCTTGGATACACAGAATCTCATAAAAG
rJMSF013J08- CAGCTTGAGAGTTCCTTATGTTAAGTGCGGGTGGCTTGGATACACAGAATCTCATAAAAG
JMSF032H18+ CAGCTTGAGAGTTCCTTATGTTAAGTGCGGGTGGCTTGGATACACAGAATCTCATAAAAG
rJMSF009M16- CAGCTTGAGAGTTCCTTATGTTAAGTGCGGGTGGCTTGGATACACAGAATCTCATAAAAG
JMSF009M16+ CAGCTTGAGAGTTCCTTATGTTAAGTGCGGGTGGCTTGGATACACAGAATCTCATAAAAG
JMSF025B08+ CAGCTTGAGAGTTCCTTATGTTAAGTGCGGGTGGCTTGGATACACAGAATCTCATAAAAG
                      ____________________________________________________________
consensus CAGCTTGAGAGTTCCTTATGTTAAGTGCGGGTGGCTTGGATACACAGAATCTCATAAAAG
 
. : . : . : . : . : . :
rJMFF019M02- TATAGGAGGAAGAAGAAGAGGGAGTTGCTGGCGGCGATTGTACCACCGATCGGTTTGGGA
JMSF025A06+ TATAGGAGGAAGAAGAAGAGGGAGTTGCTGGCGGCGATTGTACCACCGATCGGTTTGGGA
rJMSF013J08- TATAGGAGGAAGAAGAAGAGGGAGTTGCTGGCGGCGATTGTACCACCGATCGGTTTGGGA
JMSF032H18+ TATAGGAGGAAGAAGAAGAGGGAGTTGCTGGCGGCGATTGTACCACCGATCGGTTTGGGA
rJMSF009M16- TATAGGAGGAAGAAGAAGAGGGAGTTGCTGGCGGCGATTGTACCACCGATCGGTTTGGGA
JMSF009M16+ TATAGGAGGAAGAAGAAGAGGGAGTTGCTGGCGGCGATTGTACCACCGATCGGTTTGGGA
JMSF013J08+ TAGGAGGAAGAAGAAGANGGANTTGCNGGCGGCGATTGTACCACCGATCGGTTTGGGA
JMSF025B08+ TATAGGAGGAAGAAGAAGAGGGAGTTGCTGGCGGCGATTGTACCACCGATCGGTTTGGGA
                      ____________________________________________________________
consensus TATAGGAGGAAGAAGAAGAGGGAGTTGCTGGCGGCGATTGTACCACCGATCGGTTTGGGA
 
. : . : . : . : . : . :
rJMFF019M02- ATTTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCAC
JMSF025A06+ ATTTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCACCG
rJMSF013J08- ATTTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCACCG
JMSF032H18+ ATTTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCACCG
rJMSF009M16- ATTTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCACCG
JMSF009M16+ ATTTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCACCG
JMSF013J08+ ATNTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCACCG
JMSF025B08+ ATTTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCACCG
                      ____________________________________________________________
consensus ATTTGATGCATGGGAATGAAGACGATGATGCCACTGACATTTTCTTGATTCTTGGCACCG
 
. : . : . : . : . : . :
JMSF025A06+ C
rJMSF013J08- CA
JMSF032H18+ CAGAGGAAGAC
rJMSF009M16- CAGANGAAGACGAT
JMSF009M16+ CAGAGGAAGACGAT
JMSF013J08+ CAGAGGAAGACGATGGAGTAAGTGGATGACAGGAAAGTTGTTTGGTCAAATAGTTATCAG
JMSF025B08+ CAGAGGAAGACGATGGAGTAAGTGGATGACAGGAAAGTTGTTTGGTCAAATAGTTATCAG
                      ____________________________________________________________
consensus CAGAGGAAGACGATGGAGTAAGTGGATGACAGGAAAGTTGTTTGGTCAAATAGTTATCAG
 
. : . : . : . : . : . :
JMSF013J08+ AAACTTCAT
JMSF025B08+ AAACTTCATGCTGCTGATTTGTGGATAACATCTGCCCAACCCAACACTACAAAACAACCC
                      ____________________________________________________________
consensus AAACTTCATGCTGCTGATTTGTGGATAACATCTGCCCAACCCAACACTACAAAACAACCC