Previous Contig 006266:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051P04Sequence505006266 (3)gb:AB061795_15220882e-14Bruguiera gymnorhiza bg55 mRNA, complete cds.637021949gb:AY087183_15722170.011Arabidopsis thaliana clone 32599 mRNA, complete sequence.
JMSF025A21Sequence535006266 (3)gb:AB061795_15220882e-04Bruguiera gymnorhiza bg55 mRNA, complete cds.728013132 (2)gb:AB061795_15220885e-29Bruguiera gymnorhiza bg55 mRNA, complete cds.
JMSF037P05Sequence650006266 (3)gb:AB061795_15220884e-32Bruguiera gymnorhiza bg55 mRNA, complete cds.666013132 (2)gb:AB061795_15220889e-30Bruguiera gymnorhiza bg55 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037P05+ CTCTGCAGCCAGCAATACGG
                      ____________________________________________________________
consensus CTCTGCAGCCAGCAATACGG
 
. : . : . : . : . : . :
JMSF037P05+ GAACCATGTTTTGAATCTGGCTCAAGCTAACCTCCAGTAAGCTCCACGACTTTTGACACC
                      ____________________________________________________________
consensus GAACCATGTTTTGAATCTGGCTCAAGCTAACCTCCAGTAAGCTCCACGACTTTTGACACC
 
. : . : . : . : . : . :
JMFF051P04+ TTTCAGAGCCAAGTAGAGTTTACTTGATTCACTGCACGGCT
JMSF037P05+ TCGAGAGTATAACATCTCCTTTCAGAGCCAAGTAGAGTTTACTTGATTCACTGCACTGCT
                      ____________________________________________________________
consensus TCGAGAGTATAACATCTCCTTTCAGAGCCAAGTAGAGTTTACTTGATTCACTGCACTGCT
 
. : . : . : . : . : . :
JMFF051P04+ TAAGTATTAACTTCGCCTTCTCAATGGCTTTGTTCAATAAGCAAAGCGCCTCTATCCCTG
JMSF037P05+ TAAGTATTAACTTCGCCTTCTCAATGGCTTTGTTCAATAAGCAAAGCGCCTCTATCCCTG
                      ____________________________________________________________
consensus TAAGTATTAACTTCGCCTTCTCAATGGCTTTGTTCAATAAGCAAAGCGCCTCTATCCCTG
 
. : . : . : . : . : . :
JMFF051P04+ ATCTGCATCGAGGCCGGGATGCTTCTATTCGCTGGAAGTATTTTTGAAGCTCTACTTACT
JMSF037P05+ ATCTGCATCGAGGCCGGGATGCTTCTA-TCGCTGGAAGTATTTTTGAAGCTCTACTTACT
JMSF025A21+ GCATCGAGGCCGGGATGCTTCTA-TCGCTGGAAGTATTTTTGAAGCTCTACTTACT
                      ____________________________________________________________
consensus ATCTGCATCGAGGCCGGGATGCTTCTA-TCGCTGGAAGTATTTTTGAAGCTCTACTTACT
 
. : . : . : . : . : . :
JMFF051P04+ GAGTTGATTAATTCTGTGCACATTAACCGATGCACCTTAATGGAGTTAGGAGTTGGAAGT
JMSF037P05+ GAGTTGATTAATTCTGTGCACATTAACCGATGCACCTTAATGGAGTTAGGAGTTGGAAGT
JMSF025A21+ GAGTTGATTAATTCTGTGCACATTAACTGATGCACCTTAATGGAGTTAGGAGTTGGAAGT
                      ____________________________________________________________
consensus GAGTTGATTAATTCTGTGCACATTAACCGATGCACCTTAATGGAGTTAGGAGTTGGAAGT
 
. : . : . : . : . : . :
JMFF051P04+ GCTTCAGTAACAACTGTCTTCATACTCAAAGGAAATGGAAACGGAAGAACAGATAACTTA
JMSF037P05+ GCTTCAGTAACAACTGTCTTCATACTCAAAGGAAATGGAAACAGAAGAACAGATAACTTA
JMSF025A21+ GCTTCAGTAACAACTGTCTTCATACTCAAAGGAAATGGAAACAGAAGAACAGATAACTTA
                      ____________________________________________________________
consensus GCTTCAGTAACAACTGTCTTCATACTCAAAGGAAATGGAAACAGAAGAACAGATAACTTA
 
. : . : . : . : . : . :
JMFF051P04+ TCT
JMSF037P05+ TCTAGCAAAAAGGTAGAGTTATCAAGACCACCAAATAACTACACTTCTGGAAACAGAAAC
JMSF025A21+ TCTAGCAAAAAGGTAGAGTTATCAAGACCACCAAATAACTACACTTCTGGAAACAGAAAC
                      ____________________________________________________________
consensus TCTAGCAAAAAGGTAGAGTTATCAAGACCACCAAATAACTACACTTCTGGAAACAGAAAC
 
. : . : . : . : . : . :
JMSF037P05+ CCAAACCCAATGGCCAATTCCCTTCTGGAACCACACCCACCTTGAAAAGCTGCAAGCTTT
JMSF025A21+ CCAAACCCAATGGCCAATTCCCTTCTGGAACCACACCCACCTTGAAAAGCTGCAAGCTTT
                      ____________________________________________________________
consensus CCAAACCCAATGGCCAATTCCCTTCTGGAACCACACCCACCTTGAAAAGCTGCAAGCTTT
 
. : . : . : . : . : . :
JMSF037P05+ CCAGCAAACTTGAATAGAATATTACAAATGACAACTTTCAAGAAAAGCTCCTCCTTCTTC
JMSF025A21+ CCAGCAAACTTGAATAGAATATTACAAATGACAACTTTCAAGAAAAGCTCCTCCTTCTTC
                      ____________________________________________________________
consensus CCAGCAAACTTGAATAGAATATTACAAATGACAACTTTCAAGAAAAGCTCCTCCTTCTTC
 
. : . : . : . : . : . :
JMSF037P05+ TTCTTCTTCTTCTTTTCTTTTCCGAACAAAGGAACCCGATTCTGAACTGAGATTACAATT
JMSF025A21+ TTCTTCTTCTTCTTTTCTTTTCCGAACAAAGGAACCCGATTCTGAACTGAGATTACAATT
                      ____________________________________________________________
consensus TTCTTCTTCTTCTTTTCTTTTCCGAACAAAGGAACCCGATTCTGAACTGAGATTACAATT
 
. : . : . : . : . : . :
JMSF037P05+ TCAAACACAAATCAACCTTATTGAGACCA
JMSF025A21+ TCAAACACAAATCAACCTTATTGAGACCACAGAAGACCAAGGAATGATGGATGCACGCAC
                      ____________________________________________________________
consensus TCAAACACAAATCAACCTTATTGAGACCACAGAAGACCAAGGAATGATGGATGCACGCAC
 
. : . : . : . : . : . :
JMSF025A21+ AAATGTACAAGCATTTACAAACAGCATTAAAGAGATACCTAACCACCCAGTCACATCTTC
                      ____________________________________________________________
consensus AAATGTACAAGCATTTACAAACAGCATTAAAGAGATACCTAACCACCCAGTCACATCTTC