Previous Contig 006264:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016N02Sequence549014400gb:AP003335_18281434e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114696006264 (2)gb:AP003335_18281432e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF025A03Sequence620006264 (2)gb:AE005173_8943517e-50Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC002130_153208023151

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016N02+ GATTAATGGCGCGAAAAAGGGGACCTCGGCCTGGGGACGCGGCGGAGGATCCGAA
JMSF025A03+ GGACGCGGCGGAGGATCCGAA
                      ____________________________________________________________
consensus GATTAATGGCGCGAAAAAGGGGACCTCGGCCTGGGGACGCGGCGGAGGATCCGAA
 
. : . : . : . : . : . :
rJMFF016N02+ TTTCACGCCGGTGCTTTACAACCCGGATAAACCCAAAGGCCAAAGATTTACCGAGTTAAA
JMSF025A03+ TTTCACGNCGGTGCTTTACAACCCGGATAAACCCAAAGGCCAAAGATTTACCGAGTTAAA
                      ____________________________________________________________
consensus TTTCACGCCGGTGCTTTACAACCCGGATAAACCCAAAGGCCAAAGATTTACCGAGTTAAA
 
. : . : . : . : . : . :
rJMFF016N02+ GCCAACTAAAATCGCCAGAATGTACCATTCCTCATCGGCAGTTTTGCCGGACGGTAAGAT
JMSF025A03+ GCCAACTAAAATCGCCAGAATGTACCATTCCTCATCGGCAGTTTTGCCGGACGGTAAGAT
                      ____________________________________________________________
consensus GCCAACTAAAATCGCCAGAATGTACCATTCCTCATCGGCAGTTTTGCCGGACGGTAAGAT
 
. : . : . : . : . : . :
rJMFF016N02+ CTTAGTCGCCGGAAGCAACACCCACGCTTCTCTACGACTTGAAAGCCAAATACCCAACCG
JMSF025A03+ NTTAGTCGCCGGAAGCAACACCCACGC-TCTGTACGACTTGAAAGCCAAATACCCAACCG
                      ____________________________________________________________
consensus CTTAGTCGCCGGAAGCAACACCCACGCTTCTGTACGACTTGAAAGCCAAATACCCAACCG
 
. : . : . : . : . : . :
rJMFF016N02+ ACTTGCGCGTCGAGAAATTCTCGCCGCCGTACTTATCTCCCGCCCTGCAAAAGTTCCGGC
JMSF025A03+ ACTTGCGCGTCGAGAAATTCTNGCCGCCGTACTTATCTCCCGCCCTGCAAAAGTTCCGGC
                      ____________________________________________________________
consensus ACTTGCGCGTCGAGAAATTCTCGCCGCCGTACTTATCTCCCGCCCTGCAAAAGTTCCGGC
 
. : . : . : . : . : . :
rJMFF016N02+ CAGAGATCTTGGAGGACGATTCAGACAAACATTTGTTCTATGGACGGAATTTCAAGATCT
JMSF025A03+ CAGAGATCTTGGAGGACGATTCAGACAAACATTTGTTCTATGGACGGAATTTCAAGATCT
                      ____________________________________________________________
consensus CAGAGATCTTGGAGGACGATTCAGACAAACATTTGTTCTATGGACGGAATTTCAAGATCT
 
. : . : . : . : . : . :
rJMFF016N02+ ATATCAAGCTGGATGCTGAGGTAGACATGTCCGATATTAAGGTGACTATGTATCCACCGC
JMSF025A03+ ATATCAAGCTGGATGCTGAGGTAGACATGTCCGATATTAAGGTGACTATGTATCCNCCGC
                      ____________________________________________________________
consensus ATATCAAGCTGGATGCTGAGGTAGACATGTCCGATATTAAGGTGACTATGTATCCACCGC
 
. : . : . : . : . : . :
rJMFF016N02+ CGTTCACCACTCACGGCTTCTCCCACGGCCAGAGGATGCTGATTTTGGGTCTTAACCACG
JMSF025A03+ CGTTCACCACTCACGGCTTCTCCCACGGCCAGAGGATGNTGATTTTGGGTCTTAACCACG
                      ____________________________________________________________
consensus CGTTCACCACTCACGGCTTCTCCCACGGCCAGAGGATGCTGATTTTGGGTCTTAACCACG
 
. : . : . : . : . : . :
rJMFF016N02+ CTTCCAACAAAGCCATCTCCGCCGTGGCCCCGCCCTCCGGCAAGCTCGCACCACCAGGCT
JMSF025A03+ CTTCCAACAAAGCCATCTCCGCCGTGGCCCCGCCNTCCGGCAAGCTCGCACCACCAGGCT
                      ____________________________________________________________
consensus CTTCCAACAAAGCCATCTCCGCCGTGGCCCCGCCCTCCGGCAAGCTCGCACCACCAGGCT
 
. : . : . : . : . : . :
rJMFF016N02+ ACTACTTGATCTTCGTCGTGCACCGTGGCGTACCCAGCAAAGGAATGTGGGTGCATATTA
JMSF025A03+ ACTACTTGATCTTCGTCGTGCACCGTGGCGTACCCAGCAAAGGAATGTGGGTGCATATTA
                      ____________________________________________________________
consensus ACTACTTGATCTTCGTCGTGCACCGTGGCGTACCCAGCAAAGGAATGTGGGTGCATATTA
 
. : . : . : . : . : . :
rJMFF016N02+ A
JMSF025A03+ ATTAAATATAATATCAGATCGATGGGCTTTTAAAAATCGAAATCTTTCTTGTACTCTATC
                      ____________________________________________________________
consensus ATTAAATATAATATCAGATCGATGGGCTTTTAAAAATCGAAATCTTTCTTGTACTCTATC