Previous Contig 006263:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN015I15Sequence530006263 (4)gb:AP005681_18559130.049Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ14
JMSF024P23Sequence623006263 (4)gb:AP005681_18559134e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ14766006263 (4)gb:AP005681_18559131e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ14
JMSF025P23Sequence512006263 (4)gb:AP005681_18559131e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ14

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN015I15+ ACGGAACAAATTCTTCAATTTCTTTCCACTAGAGAATAGA
                      ____________________________________________________________
consensus ACGGAACAAATTCTTCAATTTCTTTCCACTAGAGAATAGA
 
. : . : . : . : . : . :
JMFN015I15+ GATTTAGCAAAAGTACAATTGGGCATACACTCATTATATCACCTATATATGTATATATAT
                      ____________________________________________________________
consensus GATTTAGCAAAAGTACAATTGGGCATACACTCATTATATCACCTATATATGTATATATAT
 
. : . : . : . : . : . :
JMFN015I15+ AAATGGAAAACTTCACAGCACAGCAATTAACAGTGAAATCCTACTAATCTTACTATAGAA
rJMSF024P23- CAGCACAGCAATTAACAGTGAAATCCTACTAATCTTACTATAGAA
                      ____________________________________________________________
consensus AAATGGAAAACTTCACAGCACAGCAATTAACAGTGAAATCCTACTAATCTTACTATAGAA
 
. : . : . : . : . : . :
JMFN015I15+ AAATTCCCTAATGCTACTAACTAGCTACCCAGAAAAATAGAACGAAGCCCTCACAATCTT
rJMSF024P23- AAATTCCCTAATGCTACTAACTAGCTACCCAGAAAAATAGAACGAAGCCCTCACAATCTT
                      ____________________________________________________________
consensus AAATTCCCTAATGCTACTAACTAGCTACCCAGAAAAATAGAACGAAGCCCTCACAATCTT
 
. : . : . : . : . : . :
JMFN015I15+ AATTCACTGATTCAGTAGGCAGTATTTGGGAGACGAAAAATAGAACGAAATCGAATCAGA
rJMSF024P23- AATTCACTGATTCAGTAGGCAGTATTTGGGAGAAGAAAAATAGAACGAAATCGAATCAGA
                      ____________________________________________________________
consensus AATTCACTGATTCAGTAGGCAGTATTTGGGAGACGAAAAATAGAACGAAATCGAATCAGA
 
. : . : . : . : . : . :
JMFN015I15+ AGACACCAATGTTATGCCTCGCCGGCCCCTGTATATTCTGGTCGAGTTTGCGCTTCAATC
rJMSF025P23- CGGCCCCTGTATATTCTGGTCGAGTTTGCGCTTCAATC
rJMSF024P23- AGACACCAATGTTATGCCTCGCCGGCCCCTGTATATTCTGGTCGAGTTTGCGCTTCAATC
                      ____________________________________________________________
consensus AGACACCAATGTTATGCCTCGCCGGCCCCTGTATATTCTGGTCGAGTTTGCGCTTCAATC
 
. : . : . : . : . : . :
JMFN015I15+ GCCCTATGCATTCTGCTATTCCTGATTATTAGAATTTTGGCCATGTATCCTGGTTGGTTT
rJMSF025P23- GCCCTATGCATTCTGCTATTCCTGATTATTAGAATTTTGGCCATGTATCCTGGTTGGTTT
rJMSF024P23- GCCCTATGCATTCTGCTATTCCTGATTATTAGAATTTTGGCCATGTATCCTGGTTGGTTT
JMSF024P23+ TGGCCATGTATCCTGGTTGGTTT
                      ____________________________________________________________
consensus GCCCTATGCATTCTGCTATTCCTGATTATTAGAATTTTGGCCATGTATCCTGGTTGGTTT
 
. : . : . : . : . : . :
JMFN015I15+ CATATTCAAATCGATCATTTTATTCTCCCTCTTGGCATGACCATCTTTAGTGTTATCTGA
rJMSF025P23- CATATTCAAATCGATCATTTTATTCTCCCTCTTGGCATGACCATCTTTAGTGTTATCTGA
rJMSF024P23- CATATTCAAATCGATCATTTTATTCTCCCTCTTGGCATGACCATCTTTAGTGTTATCTGA
JMSF024P23+ CATATTCAAATCGATCATTTTATTCTCCCTCTTGGCATGACCATCTTTAGTGTTATCTGA
                      ____________________________________________________________
consensus CATATTCAAATCGATCATTTTATTCTCCCTCTTGGCATGACCATCTTTAGTGTTATCTGA
 
. : . : . : . : . : . :
JMFN015I15+ AACCGGAACAGCGGCGGCGGCGGCGTGGTTCTGTTGGCCGGGATCTGAGGTCAGCCGCGG
rJMSF025P23- AACCGGAACAGCGGCGGCGGCGGCGTGGTTCTGTTGGCCGGGATCTGAGGTCAGCCGCGG
rJMSF024P23- AACCGGAACAGCGGCGGCGGCGGCGTGGTTCTGTTGGCCGGGATCTGAGGTCAGCCGCGG
JMSF024P23+ AACCGGAACAGCGGCGGCGGCGGCGTGGTTCTGTTGGCCGGGATCTGAGGTCAGCCGCGG
                      ____________________________________________________________
consensus AACCGGAACAGCGGCGGCGGCGGCGTGGTTCTGTTGGCCGGGATCTGAGGTCAGCCGCGG
 
. : . : . : . : . : . :
JMFN015I15+ CGGCTCCTCC
rJMSF025P23- CGGCTCCTCCGTCTGCCCAGCTTTATCTCCCGGGAACTCAACTCTCTGCCTCATCAGAAG
rJMSF024P23- CGGCTCCTCCGTCTGCCCAGCTTTATCTCCCGGGAACTCAACTCTCTGCCTCATCAGAAG
JMSF024P23+ CGGCTCCTCCGTCTGCCCAGCTTTATCTCCCGGGAACTCAACTCTCTGCCTCATCAGAAG
                      ____________________________________________________________
consensus CGGCTCCTCCGTCTGCCCAGCTTTATCTCCCGGGAACTCAACTCTCTGCCTCATCAGAAG
 
. : . : . : . : . : . :
rJMSF025P23- ATATCTACTATGGGTTCTTTTGCCCCCAACATGCACAATCATATCACATTGCAGACACAG
rJMSF024P23- ATATCTACTATGGGTTCTTTTGCCCCCAACATGCACAATCATATCACATTGCAGACACAG
JMSF024P23+ ATATCTACTATGGGTTCTTTTGCCCCCAACATGCACAATCATATCACATTGCAGACACAG
                      ____________________________________________________________
consensus ATATCTACTATGGGTTCTTTTGCCCCCAACATGCACAATCATATCACATTGCAGACACAG
 
. : . : . : . : . : . :
rJMSF025P23- AGAACTCCCATCCACCTCACAGTAAAAAAAAGCAGGCGCATTTTCACAAATATCGCANCG
rJMSF024P23- AGAACTCCCATCCACCTCACAGTAAAAAAAAGCAGGTGCATTTTCACAAATATCGCAGCG
JMSF024P23+ AGAACTCCCATCCACCTCACAGTAAAAAAAAGCAGGTGCATTTTCACAAATATCGCAGCG
                      ____________________________________________________________
consensus AGAACTCCCATCCACCTCACAGTAAAAAAAAGCAGGTGCATTTTCACAAATATCGCAGCG
 
. : . : . : . : . : . :
rJMSF025P23- AGGAACAACAATCGGCGGATTAGCTAACCCAACTCTTACATGTCTACTTGCAAGCTTATT
rJMSF024P23- AGGAACAACAATCGGCGGATTAGCTAACCCAACTCTTACATGTCTACTTGCAAGCTTATT
JMSF024P23+ AGGAACAACAATCGGCGGATTAGCTAACCCAACTCTTACATGTCTACTTGCAAGCTTATT
                      ____________________________________________________________
consensus AGGAACAACAATCGGCGGATTAGCTAACCCAACTCTTACATGTCTACTTGCAAGCTTATT
 
. : . : . : . : . : . :
rJMSF025P23- ACACATATGTACCTTATCATCGCAGGCGCGGCAAAGGGCGGCCTCATCGGCGGC
rJMSF024P23- ACACATATGTACCTTATCATCGCAGGCGCGGCAAAGGGCGGCCTCATCGGCGGCGCANAA
JMSF024P23+ ACACATATGTACCTTATCATCGCAGGCGCGGCAAAGGGCGGCCTCATCGGCGGCGCAGAA
                      ____________________________________________________________
consensus ACACATATGTACCTTATCATCGCAGGCGCGGCAAAGGGCGGCCTCATCGGCGGCGCAGAA
 
. : . : . : . : . : . :
rJMSF024P23- CAGAATGGCGGCGGCACTTTCACACACGTCACAAAGCGTCCGCATACTTCATCTCTC
JMSF024P23+ CAGAATGGCGGCGGCACTTTCACACACGTCACAAAGCGTCCGCATACTTCATCTCTCCGA
                      ____________________________________________________________
consensus CAGAATGGCGGCGGCACTTTCACACACGTCACAAAGCGTCCGCATACTTCATCTCTCCGA
 
. : . : . : . : . : . :
JMSF024P23+ TCATCCAACCCAAAAGTTTCTGAGTTTTCTCTTCTGGTTTTTGTGCCCTGCGACTGGAAG
                      ____________________________________________________________
consensus TCATCCAACCCAAAAGTTTCTGAGTTTTCTCTTCTGGTTTTTGTGCCCTGCGACTGGAAG
 
. : . : . : . : . : . :
JMSF024P23+ GTTTAAAAGAAAATCAAATTGAAGAAGAAGAAGAGAGGAGACAAGGAAAAATGTTAGTTC
                      ____________________________________________________________
consensus GTTTAAAAGAAAATCAAATTGAAGAAGAAGAAGAGAGGAGACAAGGAAAAATGTTAGTTC