Previous Contig 006258:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013C05Sequence568006258 (11)gb:AF307336_17846623e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.695006258 (11)gb:AF307336_17846621e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMFF018D21Sequence520006258 (11)gb:AF307336_17846625e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.317006258 (11)gb:AP005589_18545822e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P052
JMFS064B06Sequence519006258 (11)gb:AF307336_17846627e-46Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMSF021J07Sequence692006258 (11)gb:AF307336_17846629e-81Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.744006258 (11)gb:AF307336_17846621e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMSF024P05Sequence685006258 (11)gb:AF307336_17846629e-81Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.714006258 (11)gb:AF307336_17846621e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMSF043B13Sequence476006258 (11)gb:AF307336_17846623e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.600006258 (11)gb:AF307336_17846624e-68Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS064B06+ AATGTAAAACAGTATATCATTTTTAACCTTAACATACAAAATTA
rJMSF043B13- AAATTA
rJMFF013C05- AAATTA
                      ____________________________________________________________
consensus AATGTAAAACAGTATATCATTTTTAACCTTAACATACAAAATTA
 
. : . : . : . : . : . :
JMFS064B06+ ACTCCATAATCTCTTCAGAAAATTTGAATAGTGACAATCCACTACCAATACAATTCTCAA
rJMSF043B13- ACTCCATAATCTCTTCAGAAAATTTGAATAGTGACAATCCACTACCAATACAATTCTCAA
rJMFF013C05- ACTCCATAATCTCTTCAGAAAATTTGAATAGTGACAATCCACTACCAATACAATTCTCAA
JMSF021J07+ ATAGTGACAATCCACTACCAATACAATTCTCAA
rJMSF024P05- TAATCTCTTCAGAAAATTTGAATAGTGACAATCCACTACCAATACAATTCTCAA
JMSF024P05+ AATCCACTACCAATACAATTCTCAA
                      ____________________________________________________________
consensus ACTCCATAATCTCTTCAGAAAATTTGAATAGTGACAATCCACTACCAATACAATTCTCAA
 
. : . : . : . : . : . :
rJMFF018D21- ATATG
JMFS064B06+ CATAAAGTAGGGGATATGTAAGAAACACAGCTCTATCAAGGCTCAGGAACAACAAATATG
rJMSF043B13- CATAAAGTAGGGGATATGTAAGAAACACAGCTCTATCAAGGCTCAGGAACAACAAATATG
rJMFF013C05- CATAAAGTAGGGGATATGTAAGAAACACAGCTCTATCAAGGCTCAGGAACAACAAATATG
JMSF021J07+ CATAAAGTAGGGGATATGTAAGAAACACAGCTCTATCAAGGCTCAGGAACAACAAATATG
rJMSF024P05- CATAAAGTAGGGGATATGTAAGAAACACAGCTCTATCAAGGCTCAGGAACAACAAATATG
JMSF024P05+ CATAAAGTAGGGGATATGTAAGAAACACAGCTCTATCAAGGCTCAGGAACAACAAATATG
                      ____________________________________________________________
consensus CATAAAGTAGGGGATATGTAAGAAACACAGCTCTATCAAGGCTCAGGAACAACAAATATG
 
. : . : . : . : . : . :
rJMFF018D21- GAAAAGAAAGCCTAAGCCTTCCTGGATTTGGNGGTTGCTATTTGNGACTCAGGCTCCTTC
JMFS064B06+ GAAAAGAAAGCCTAAGCCTTCCTGGATTTGGTGGTTGCTATTTGTGACTCAGGCTCCTTC
rJMSF043B13- GAAAAGAAAGCCTAAGCCTTCCTGGATTTGGTGGTTGCTATTTGTGACTCAGGCTCCTTC
rJMFF013C05- GAAAAGAAAGCCTAAGCCTTCCTGGATTTGGTGGTTGCTATTTGTGACTCAGGCTCCTTC
rJMSF021J07- TAAGCCTTCCTGGATTTGGTGGTTGCTATTTGTGACTCAGGCTCCTTC
JMSF021J07+ GAAAAGAAAGCCTAAGCCTTCCTGGATTTGGTGGTTGCTATTTGTGACTCAGGCTCCTTC
JMFF013C05+ GTGGTTGCTATTTGTGACTCAGGCTCCTTC
rJMSF024P05- GAAAAGAAAGCCTAAGCCTTCCTGGATTTGGTGGTTGCTATTTGTGACTCAGGCTCCTTC
JMSF024P05+ GAAAAGAAAGCCTAAGCCTTCCTGGATTTGGTGGTTGCTATTTGTGACTCAGGCTCCTTC
                      ____________________________________________________________
consensus GAAAAGAAAGCCTAAGCCTTCCTGGATTTGGTGGTTGCTATTTGTGACTCAGGCTCCTTC
 
. : . : . : . : . : . :
rJMFF018D21- NTGACAGGTTCTTCCTTCTCACAAAGGATTAACTCAATGTGGCAAGGGGAANACNTGTAA
JMFS064B06+ TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
rJMSF043B13- TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
rJMFF013C05- TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
rJMSF021J07- TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
JMSF021J07+ TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
JMFF018D21+ TCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
JMSF043B13+ TCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
JMFF013C05+ TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
rJMSF024P05- TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
JMSF024P05+ TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
                      ____________________________________________________________
consensus TTGACAGGTTCTTCCTTCTCAGAAAGGATTAACTCAATGTGGCAAGGGGAAGACATGTAA
 
. : . : . : . : . : . :
rJMFF018D21- AGGTTAATTCTTCCGTGANCACGGNATGTGCGCANCCTCTGCTTCTGGGCTTGGNTAACC
JMFS064B06+ GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
rJMSF043B13- GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
rJMFF013C05- GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
rJMSF021J07- GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
JMSF021J07+ GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
JMFF018D21+ GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCAGCCTCTGCTTCTGGGCTTGGTTAACC
JMSF043B13+ GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
JMFF013C05+ GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
rJMSF024P05- GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
JMSF024P05+ GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
                      ____________________________________________________________
consensus GGGTTAATTCTTCCGTGAGCACGGTATGTGCGCCGCCTCTGCTTCTGGGCTTGGTTAACC
 
. : . : . : . : . : . :
rJMFF018D21- TGGACGTGGGANATGTAAAGNGTATCCACATCNAGCCCTTTCACCTCANCATTGCTTTCA
JMFS064B06+ TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
rJMSF043B13- TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
rJMFF013C05- TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
rJMSF021J07- TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
JMSF021J07+ TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
JMFF018D21+ TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
JMSF043B13+ TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
JMFF013C05+ TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
rJMSF024P05- TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
JMSF024P05+ TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
                      ____________________________________________________________
consensus TGGACGTGGGAGATGTAAAGTGTATCCACATCGAGCCCTTTCACCTCAGCATTGCTTTCA
 
. : . : . : . : . : . :
rJMFF018D21- NCATTCTTGAGCANATCNAGAATGAACTTGGNAGATTTCACGNGCCACCTTCCCTGTCCA
JMFS064B06+ GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
rJMSF043B13- GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
rJMFF013C05- GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
rJMSF021J07- GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
JMSF021J07+ GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
JMFF018D21+ GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
JMSF043B13+ GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
JMFF013C05+ GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
rJMSF024P05- GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
JMSF024P05+ GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
                      ____________________________________________________________
consensus GCATTCTTGAGCAAATCGAGAATGAACTTGGCAGATTTCACGGGCCACCTTCCCTGTCCA
 
. : . : . : . : . : . :
rJMFF018D21- TTGGGATGCCTG
JMFS064B06+ TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGG
rJMSF043B13- TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
rJMFF013C05- TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
rJMSF021J07- TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
JMSF021J07+ TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
JMFF018D21+ TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
JMSF043B13+ TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
JMFF013C05+ TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
rJMSF024P05- TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
JMSF024P05+ TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
                      ____________________________________________________________
consensus TTGGGATGCCTGTTCTTAGCCTGAGCAGTCCTTCCAACACCACGGCAGAAGCGGGTAAAG
 
. : . : . : . : . : . :
rJMSF043B13- GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
rJMFF013C05- GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
rJMSF021J07- GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
JMSF021J07+ GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
JMFF018D21+ GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
JMSF043B13+ GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
JMFF013C05+ GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
rJMSF024P05- GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
JMSF024P05+ GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
                      ____________________________________________________________
consensus GGAATGGCCTGCTTGTGGGCCAAAACATCTTCTAGATACCTTTTAGCCTTTACCAAAGGA
 
. : . : . : . : . : . :
rJMSF043B13- AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGA
rJMFF013C05- AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
rJMSF021J07- AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
JMSF021J07+ AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
JMFF018D21+ AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
JMSF043B13+ AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
JMFF013C05+ AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
rJMSF024P05- AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
JMSF024P05+ AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
                      ____________________________________________________________
consensus AGCTTCCTGATAGCATGTGCTGTTTCCCTAGTGTTCTTGAAATGAACTCTGAGATCTGAG
 
. : . : . : . : . : . :
rJMFF013C05- CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
rJMSF021J07- CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
JMSF021J07+ CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
JMFF018D21+ CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
JMSF043B13+ CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
JMFF013C05+ CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
rJMSF024P05- CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
JMSF024P05+ CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
                      ____________________________________________________________
consensus CCCCTAGCTTTGCAGGATTTGGTGGGATTATCGGGCTCCCTCGAGTACTTCACCATGGCG
 
. : . : . : . : . : . :
rJMFF013C05- CCTGCTGCTTCGGCTGCTGCTTCAG
rJMSF021J07- CCTGCTGCTTCGGCTGCTGCTTCAGAAGCGAGATTAGGGTTTGCTCCTTCC
JMSF021J07+ CCTGCTGCTTCGGCTGCTGCTTCAGAAGCGAGATTAGGGTTTGCTCCTTCCTGCTTTC
JMFF018D21+ CCTGCTGCTTCGGCTGCTGCTTCAGAAGCGAGATTAGGGTTTGCTCCTTCCTGCT
JMSF043B13+ CCTGCTGCTTCGGC
JMFF013C05+ CCTGCTGCTTCGGCTGCTGCTTCAGAAGCGAGATTAGGGTTTGCTCCTTCCTGCTTTC
rJMSF024P05- CCTGCTGCTTCGGCTGCTGCTTCAGAAGCGAGATTAGGGTTTGCTCCTTCCTGCTTTC
JMSF024P05+ CCTGCTGCTTCGGCTGCTGCTTCAGAAGCGAGATTAGGGTTTGCTCCTTCCTGCTTTCCC
                      ____________________________________________________________
consensus CCTGCTGCTTCGGCTGCTGCTTCAGAAGCGAGATTAGGGTTTGCTCCTTCCTGCTTTCCC