Previous Contig 006257:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN033F02Sequence506006257 (8)gb:BT004664_16376981e-25Arabidopsis thaliana At4g15810 gene, complete cds.>gb:AK119086_1817030 Arabidops
JMFN036B21Sequence619006257 (8)gb:BT004664_16376982e-25Arabidopsis thaliana At4g15810 gene, complete cds.>gb:AK119086_1817030 Arabidops
JMFN040N06Sequence488006257 (8)gb:BT004664_16376981e-25Arabidopsis thaliana At4g15810 gene, complete cds.>gb:AK119086_1817030 Arabidops
JMFN044B22Sequence619006257 (8)gb:BT004664_16376983e-23Arabidopsis thaliana At4g15810 gene, complete cds.>gb:AK119086_1817030 Arabidops
JMSF018N01Sequence267006257 (8)gb:BT004664_16376984e-16Arabidopsis thaliana At4g15810 gene, complete cds.>gb:AK119086_1817030 Arabidops663006257 (8)gb:BT004664_16376982e-25Arabidopsis thaliana At4g15810 gene, complete cds.>gb:AK119086_1817030 Arabidops
JMSF024P01Sequence697006257 (8)gb:BT004664_16376983e-25Arabidopsis thaliana At4g15810 gene, complete cds.>gb:AK119086_1817030 Arabidops663006257 (8)gb:BT004664_16376982e-25Arabidopsis thaliana At4g15810 gene, complete cds.>gb:AK119086_1817030 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044B22+ TTTCCAACTGAACAAAAAAAGTTTN
JMSF024P01+ TTTGGTAAAATATTTTCCAACTGAACAAAAAAAGTTTT
                      ____________________________________________________________
consensus TTTGGTAAAATATTTTCCAACTGAACAAAAAAAGTTTT
 
. : . : . : . : . : . :
JMFN036B21+ CAGCAGCCACT-GCCACATAAAGTTTATATCAACATGGCA
rJMSF018N01- AATTGATCTGCCGACACAGCAGCCACT-GCCACATAAAGTTTATATCAACATGGCA
rJMSF024P01- AATTGATCTGCCGACACAGCAGCCACTGGCCACATAAAGTTTATATCAACATGGCA
JMFN044B22+ AACAAATTGATCTGCCGACACAGCAGCCACT-GCCACATAAAGTTTATATCAACATGGCA
JMSF024P01+ AACAAATTGATCTGCCGACACAGCAGCCACT-GCCACATAAAGTTTATATCAACATGGCA
                      ____________________________________________________________
consensus AACAAATTGATCTGCCGACACAGCAGCCACT-GCCACATAAAGTTTATATCAACATGGCA
 
. : . : . : . : . : . :
JMFN040N06+ AACTCTTACGACGTGACATTGTAGGA
JMFN036B21+ CAACCAAACACAACCAACATGATAAGAAAGCAGAAACTCTTACGACGTGACATTGTAGGA
JMFN033F02+ CAGAAACTCTTACGACGTGACATTGTAGGA
rJMSF018N01- CAACCAAACACAACCAACATGATAAGAAAGCAGAAACTCTTACGACGTGACATTGTAGGA
rJMSF024P01- CAACCAAACACAACCAACATGATAAGAAAGCAGAAACTCTTACGACGTGACATTGTAGGA
JMFN044B22+ CAACCAAACACAACCAACATGATAAGAAAGCAGAAACTCTTACGACGTGACATTGTAGGA
JMSF024P01+ CAACCAAACACAACCAACATGATAAGAAAGCAGAAACTCTTACGACGTGACATTGTAGGA
                      ____________________________________________________________
consensus CAACCAAACACAACCAACATGATAAGAAAGCAGAAACTCTTACGACGTGACATTGTAGGA
 
. : . : . : . : . : . :
JMFN040N06+ TTTGTAGGGAAAATGATAGTCAAATCAACAAGTTCAAGTCACTCCAGAATTTTTCGGACT
JMFN036B21+ TTTGTAGGGAAAATGATAGTCAAATCAACAAGTTCAAGTCACTCCAGAATTTTTCGGACT
JMFN033F02+ TTTGTAGGGAAAATGATAGTCAAATCAACAAGTTCAAGTCACTCCAGAATTTTTCGGGCT
rJMSF018N01- TTTGTAGGGAAAATGATAGTCAAATCAACAAGTTCAAGTCACTCCAGAATTTTTCGGACT
rJMSF024P01- TTTGTAGGGAAAATGATAGTCAAATCAACAAGTTCAAGTCACTCCAGAATTTTTCGGACT
JMFN044B22+ TTTGTAGGGAAAATGATAGTCAAATCAACAAGTTCAAGTCACTCCAGAATTTTTCGGACT
JMSF024P01+ TTTGTAGGGAAAATGATAGTCAAATCAACAAGTTCAAGTCACTCCAGAATTTTTCGGACT
                      ____________________________________________________________
consensus TTTGTAGGGAAAATGATAGTCAAATCAACAAGTTCAAGTCACTCCAGAATTTTTCGGACT
 
. : . : . : . : . : . :
JMFN040N06+ GAATAAGGTGTGTGAGTGATGCTCTCAAGTAGATACAGTTAGAGATGATGAAAATATACT
JMFN036B21+ GAATAAGGTGTGTGAGTGATGCTCTCAAGTAGATACAGTTAGAGATGATGAAAATATACT
JMFN033F02+ GAATAAGGTGTGTGAGTGATGCTCTCAAGTAGATACAGTTAGAGATGATGAAAATATACT
rJMSF018N01- GAATAAGGTGTGTGAGTGATGCTCTCAAGTAGATACAGTTAGAGATGATGAAAATATACT
rJMSF024P01- GAATAAGGTGTGTGAGTGATGCTCTCAAGTAGATACAGTTAGAGATGATGAAAATATACT
JMFN044B22+ GAATAAGGTGTGTGAGTGATGCTCTCAAGTAGATACAGTTAGAGATGATGAAAATATACT
JMSF024P01+ GAATAAGGTGTGTGAGTGATGCTCTCAAGTAGATACAGTTAGAGATGATGAAAATATACT
                      ____________________________________________________________
consensus GAATAAGGTGTGTGAGTGATGCTCTCAAGTAGATACAGTTAGAGATGATGAAAATATACT
 
. : . : . : . : . : . :
JMFN040N06+ CAAGTAAATCATACTGAAAATATAGATTTTGCACCTAATTTTAGGCAGAATCGGTGCCTG
JMFN036B21+ CAAGTAAATCATACTGAAAATATAGATTTTGCACCTAATTTTAGGCAGAATCGGTGCCTG
JMFN033F02+ CAAGTAAATCATACTGAAAATATAGATTTTGCACCTAATTTTAGGCAGAATCGGTGCCTG
rJMSF018N01- CAAGTAAATCATACTGAAAATATAGATTTTGCACCTAATTTTAGGCAGAATCGGTGCCTG
rJMSF024P01- CAAGTAAATCATACTGAAAATATAGATTTTGCACCTAATTTTAGGCAGAATCGGTGCCTG
JMFN044B22+ CAAGTAAATCATACTGAAAATATAGATTTTGCACCTAATTTTAGGCAGAATCGGTGCCTG
JMSF024P01+ CAAGTAAATCATACTGAAAATATAGATTTTGCACCTAATTTTAGGCAGAATCGGTGCCTG
                      ____________________________________________________________
consensus CAAGTAAATCATACTGAAAATATAGATTTTGCACCTAATTTTAGGCAGAATCGGTGCCTG
 
. : . : . : . : . : . :
JMFN040N06+ AGCCTGACTTGGGTTCATCTCTTGTCTTCATCCCTGCTGAAGGCGATGGAGCATCTTGAC
JMFN036B21+ AGCCTGACTTGGGTTCATCTCTTGTCTTCATCCCTGCTGAAGGCGATGGAGCATCTTGAC
JMFN033F02+ AGCCTGACTTGGGTTCATCTCTTGTCTTCATCCCTGCTGAAGGCGATGGAGCATCTTGAC
rJMSF018N01- AGCCTGACTTGGGTTCATCTCTTGTCTTCATCCCTGCTGAAGGCGATGGAGCATCTTGAC
rJMSF024P01- AGCCTGACTTGGGTTCATCTCTTGTCTTCATCCCTGCTGAAGGCGATGGAGCATCTTGAC
JMFN044B22+ AGCCTGACTTGGGTTCATCTCTTGTCTTCATCCCTGCTG-AGGCGATGGAGCATCTTGAC
JMSF024P01+ AGCCTGACTTGGGTTCATCTCTTGTCTTCATCCCTGCTGAAGGCGATGGAGCATCTTGAC
                      ____________________________________________________________
consensus AGCCTGACTTGGGTTCATCTCTTGTCTTCATCCCTGCTGAAGGCGATGGAGCATCTTGAC
 
. : . : . : . : . : . :
JMFN040N06+ CCATTTCTGCCCTAAGATCATTGATGCTCTGCTCTAATTCATCAACCCGGTTGCCCATCT
JMFN036B21+ CCATTTCTGCCCTAAGATCATTGATGCTCTGCTCTAATTCATCAACCCGGTTGCCCATCT
JMFN033F02+ CCATTTCTGCCCTAAGATCATTGATGCTCTGCTCTAATTCATCAACCCGGTTGCCCATCT
rJMSF018N01- CCATTTCTGCCCTAAGATCATTGATGCTCTGCTCTAATTCATCAACCCGGTTGCCCATCT
rJMSF024P01- CCATTTCTGCCCTAAGATCATTGATGCTCTGCTCTAATTCATCAACCCGGTTGCCCATCT
JMFN044B22+ CCATTTCTGCCCTAAGATCATTGATGCTCTGCTCTAATTCATCAACCCGGTTGCCCATCT
JMSF018N01+ TCTAATTCATCAACCCGGTTGCCCATCT
JMSF024P01+ CCATTTCTGCCCTAAGATCATTGATGCTCTGCTCTAATTCATCAACCCGGTTGCCCATCT
                      ____________________________________________________________
consensus CCATTTCTGCCCTAAGATCATTGATGCTCTGCTCTAATTCATCAACCCGGTTGCCCATCT
 
. : . : . : . : . : . :
JMFN040N06+ CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
JMFN036B21+ CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
JMFN033F02+ CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
rJMSF018N01- CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
rJMSF024P01- CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
JMFN044B22+ CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
JMSF018N01+ CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
JMSF024P01+ CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
                      ____________________________________________________________
consensus CATCAATTTTTGAAATGATAGATTCAGACATGGCCTGAAACCTTGTTTGCATTTGCTGAA
 
. : . : . : . : . : . :
JMFN040N06+ GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
JMFN036B21+ GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
JMFN033F02+ GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
rJMSF018N01- GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
rJMSF024P01- GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
JMFN044B22+ GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
JMSF018N01+ GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
JMSF024P01+ GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
                      ____________________________________________________________
consensus GAAGATTTTGCACAAACACAGTCATATCTCCAGTGCTTTGTTTTGAACCATCTGCATCAT
 
. : . : . : . : . : . :
JMFN040N06+ GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTC
JMFN036B21+ GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTCTTCTTCTCAGCCGGTATT
JMFN033F02+ GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTCTTCTTCTCAGCCGG
rJMSF018N01- GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTCTTCTTCTCAGCCGGTATT
rJMSF024P01- GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTCTTCTTCTCAGCCGGTATT
JMFN044B22+ GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTCTTCTTCTCAGCCGG
JMSF018N01+ GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTCTTCTTCTCAGCCGGTATT
JMSF024P01+ GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTCTTCTTCTCAGCCGGTATT
                      ____________________________________________________________
consensus GCCCATCCATTTCTGAGCGACTTCTTCTTCTTCTTCTTCTTCTTCTTCTCAGCCGGTATT
 
. : . : . : . : . : . :
JMFN036B21+ GGCTCGCAACTCAAAATGAGAACGAGGCTGCTCGCTTCGC
rJMSF018N01- GGCTCGCAACTCAAAATGAGAACGAGGCTGCTCGCTTCGCTTCTGACTTGAGCGCTCTC
rJMSF024P01- GGCTCGCAACTCAAAATGAGAACGAGGCTGCTCGCTTCGCTTCTGACTTGAGCGCTCTC
JMSF018N01+ GGCTCGCAACTCAAAATGAGAACGAGGCTGCTCGCTTCGCTTCTGACTTGAGCGCTCTC
JMSF024P01+ GGCTCGCAACTCAAAATGAGAACGAGGCTGCTCGCTTCGCTTCTGACTTGAGCGCTCTCC
                      ____________________________________________________________
consensus GGCTCGCAACTCAAAATGAGAACGAGGCTGCTCGCTTCGCTTCTGACTTGAGCGCTCTCC