Previous Contig 006254:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023P05Sequence628006254 (5)gb:AB020749_15146395e-50Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY054683_1563749006254 (5)gb:AB020749_15146393e-53Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY054683_1563
JMSF024O03Sequence693006254 (5)gb:AB020749_15146393e-49Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY054683_1563701006254 (5)gb:AB020749_15146394e-48Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY054683_1563
JMSF049D10Sequence673006254 (5)gb:AB020749_15146393e-47Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY054683_1563750024352gb:AB020749_15146391e-18Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:AY054683_1563

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024O03- ATCTCACTAACAAGAATAAACAA
rJMSF023P05- TTATATTGTTGCATGATTACAATCTCACTAACAAGAATAAACAA
                      ____________________________________________________________
consensus TTATATTGTTGCATGATTACAATCTCACTAACAAGAATAAACAA
 
. : . : . : . : . : . :
rJMSF024O03- TATAATGTAATAGAAACAAATTCGATCACCGTAGTACGTTGCTGTAGAGGAAGAAGCAAG
rJMSF023P05- TATAATGTAATAGAAACAAATTCGATCACCGTAGTACGTTGCTGTAGAGGAAGAAGCAAG
                      ____________________________________________________________
consensus TATAATGTAATAGAAACAAATTCGATCACCGTAGTACGTTGCTGTAGAGGAAGAAGCAAG
 
. : . : . : . : . : . :
rJMSF024O03- AGGTAGTACTGCTAGCTAGCTAGTCATGGTGATTTGCTAATATATAGCAGAAGAAGAGGT
rJMSF023P05- AGGTAGTACTGCTAGCTAGCTAGTCATGGTGATTTGCTAATATATAGCAGAAGAAGAGGT
                      ____________________________________________________________
consensus AGGTAGTACTGCTAGCTAGCTAGTCATGGTGATTTGCTAATATATAGCAGAAGAAGAGGT
 
. : . : . : . : . : . :
rJMSF024O03- ACAATAATATAGGTGTAATGTGATATTTGCAGAGTGAATGATGAAGATTGATCGTAAAAT
rJMSF023P05- ACAATAATATAGGTGTAATGTGATATTTGCAGAGTGAATGATGAAGATTGATCGTAAAAT
                      ____________________________________________________________
consensus ACAATAATATAGGTGTAATGTGATATTTGCAGAGTGAATGATGAAGATTGATCGTAAAAT
 
. : . : . : . : . : . :
rJMSF024O03- TCTGAGGAGTCAACCGCAAGAGGCATACCGTCGCTGTTGAGGGTGCACGACAAGGGATCA
rJMSF023P05- TCTGAGGAGTCAACCGCAAGAGGCATACCGTCGCTGTTGAGGGTGCACGACAAGGGATCA
                      ____________________________________________________________
consensus TCTGAGGAGTCAACCGCAAGAGGCATACCGTCGCTGTTGAGGGTGCACGACAAGGGATCA
 
. : . : . : . : . : . :
rJMSF024O03- GAGCCGTTGGTGCTCATCATCAGCGCCCTCAGAACTGCAGAGACTGTGTGAATATAACGA
rJMSF023P05- GAGCCGTTGGTGCTCATCATCAGCGCCCTCAGAACTGCAGAGACTGTGTGAATATAACGA
                      ____________________________________________________________
consensus GAGCCGTTGGTGCTCATCATCAGCGCCCTCAGAACTGCAGAGACTGTGTGAATATAACGA
 
. : . : . : . : . : . :
rJMSF024O03- GCTCGATTTTTGTTGAGAAGCCATGTTAGACCCATCAGCTGGCAATCTCTGCTGCGCATT
rJMSF023P05- GCTCGATTTTTGTTGAGAAGCCATGTTAGACCCATCAGCTGGCAATCTCTGCTGCGCATT
                      ____________________________________________________________
consensus GCTCGATTTTTGTTGAGAAGCCATGTTAGACCCATCAGCTGGCAATCTCTGCTGCGCATT
 
. : . : . : . : . : . :
rJMSF024O03- TTGCTTCCTCTTTCGTCTGATTTGCTTGTGCTTCTCGTTTCAGACTTGCTAAGCAGATAC
rJMSF023P05- TTGCTTCCTGTTTCGTCTGATTTGCTTGTGCTTCTCGTTTCAGACTTGCTAAGCAGATAC
                      ____________________________________________________________
consensus TTGCTTCCTGTTTCGTCTGATTTGCTTGTGCTTCTCGTTTCAGACTTGCTAAGCAGATAC
 
. : . : . : . : . : . :
rJMSF024O03- AAGCTATTCAAGCACTTGGAGCAACTGGCAAGGCTAGAATACCCATTTGCAGAAGAACTG
rJMSF023P05- AAGCTATTCAAGCACTTGGAGCAACTGGCAAGGCTAGAATACCCATTTGCAGAAGAACTG
                      ____________________________________________________________
consensus AAGCTATTCAAGCACTTGGAGCAACTGGCAAGGCTAGAATACCCATTTGCAGAAGAACTG
 
. : . : . : . : . : . :
rJMSF024O03- AAGCAATCAGTTTCCAGTCTCTTCACACTCTGATGGCCCACCAATTCGCCATGGGAATTC
rJMSF023P05- AAGCAATCAGTTTCCAGTCTCTTCACACTCTGATGGCCCACCAATTCGCCATGGGAATTC
JMSF049D10+ GCCATGGGAATTC
JMSF023P05+ TCTGATGGCCCACCAATTCGCCATGGGAATTC
JMSF024O03+ TCTGATGGCCCACCANTTCGCCATGGGAATTC
                      ____________________________________________________________
consensus AAGCAATCAGTTTCCAGTCTCTTCACACTCTGATGGCCCACCAATTCGCCATGGGAATTC
 
. : . : . : . : . : . :
rJMSF024O03- ATGGAGAAAGCTTCCGGGCAGCTCAAAGGGTGAAGCCTAATGCCACAGTAGCAGTAAACT
rJMSF023P05- ATGGAGAAAGCTTCCGGGCAGCTCAAAGGGTGAAGCCTAATGCCACAGTAGCAGTAAACT
JMSF049D10+ ATGGAGAAAGCTTCCGGGCAGCTCAAAGGGTGAAGCCTAATGCCACAGTAGCAGTAAACT
JMSF023P05+ ATGGAGAAAGCTTCCGGGCAGCTCAAAGGGTGAAGCCTAATGCCACAGTAGCAGTAAACT
JMSF024O03+ ATGGAGAAAGCTTCCGGGCAGCTCAAAGGGTGAAGCCTAATGCCACAGTAGCAGTAAACT
                      ____________________________________________________________
consensus ATGGAGAAAGCTTCCGGGCAGCTCAAAGGGTGAAGCCTAATGCCACAGTAGCAGTAAACT
 
. : . : . : . : . : . :
rJMSF024O03- ACGTCACAGGTCTGGTTGGGCTTCACCAATTCAATGCCTTTATTCCCCAGAGCCTTCTCC
rJMSF023P05- ACGTCACAGGTCTGGTTGGGCTTCACCAATTCAATGCCTTTATTCCCCAGAGCCTTCTCC
JMSF049D10+ ACGTCACAGGTCTGGTTGGGCTTCACCAATTCAATGCCTTTATTCCCCAGAGCCTTCTCC
JMSF023P05+ ACGTCACAGGTCTGGTTGGGCTTCACCAATTCAATGCCTTTATTCCCCAGAGCCTTCTCC
JMSF024O03+ ACGTCACAGGTCTGGTTGGGCTTCACCAATTCAATGCCTTTATTCCCCAGAGCCTTCTCC
                      ____________________________________________________________
consensus ACGTCACAGGTCTGGTTGGGCTTCACCAATTCAATGCCTTTATTCCCCAGAGCCTTCTCC
 
. : . : . : . : . : . :
rJMSF024O03- AGAGAATCCACGCAGG
rJMSF023P05- AGAGAATCCACGCAGGTCTCGGAGTCATCCGGGAGCACCGGCATG
JMSF049D10+ AGAGAATCCACGCAGGTCTCGGAGTCATCCGGGAGCACCGGCATGTCAAACGTCGTCGTT
JMSF023P05+ AGAGAATCCACGCAGGTCTCGGAGTCATCCGGGAGCACCGGCATGTCAAACGTCGTCGTT
JMSF024O03+ AGAGAATCCACGCAGGTCTCGGAGTCATCCGGGAGCACCGGCATGTCAAACGTCGTCGTT
                      ____________________________________________________________
consensus AGAGAATCCACGCAGGTCTCGGAGTCATCCGGGAGCACCGGCATGTCAAACGTCGTCGTT
 
. : . : . : . : . : . :
JMSF049D10+ CGAGGGATCTTGGAGGTGGCCCTTTGGAGGGCAGTTGTTGAATAGGCGGAGTAGAGCCAG
JMSF023P05+ CGAGGGATCTTGGAGGTGGCCCTTTGGAGGGCAGTTGTTGAATAGGCGGAGTAGAGCCAG
JMSF024O03+ CGAGGGATCTTGGAGGTGGCCCTTTGGAGGGCAGTTGTTGAATAGGCGGAGTAGAGCCAG
                      ____________________________________________________________
consensus CGAGGGATCTTGGAGGTGGCCCTTTGGAGGGCAGTTGTTGAATAGGCGGAGTAGAGCCAG
 
. : . : . : . : . : . :
JMSF049D10+ GCCGCGAGTACCGGGCAGCACCGGGTCCGGTGGAGAGGACCCGAATAATCATTCGACCCG
JMSF023P05+ GCCGCGAGTACCGGGCAGCACCGGGTCCGGTGGAGAGGACCCGAATAATCATTCGACCCG
JMSF024O03+ GCCGCGAGTACCGGGCAGCACCGGGTCCGGTGGAGAGGACCCGAATAATCATTCGACCCG
                      ____________________________________________________________
consensus GCCGCGAGTACCGGGCAGCACCGGGTCCGGTGGAGAGGACCCGAATAATCATTCGACCCG
 
. : . : . : . : . : . :
JMSF049D10+ CAGGCGGATTTGATCCCGCGGAAGAGCTCCTCCGTGAGGTCCAGCGGGCAGGCGGCGGTG
JMSF023P05+ CAGGCGGATTTGATCCCGCGGAAGAGCTCCTCCGTGAGGTCCAGCGGGCAGGCGGCGGTG
JMSF024O03+ CAGGCGGATTTGATCCCGCGGAAGAGCTCCTCCGTGAGGTCCAGCGGGCAGGCGGCGGTG
                      ____________________________________________________________
consensus CAGGCGGATTTGATCCCGCGGAAGAGCTCCTCCGTGAGGTCCAGCGGGCAGGCGGCGGTG
 
. : . : . : . : . : . :
JMSF049D10+ TTGGACTGCTCCGGGAACGCCGGAATCGTTGCGGACGTTGATGGGGTGGAAAATGAAACG
JMSF023P05+ TTGGACTGCTCCGGGAACGCCGGAATCGTTGCGGGCGTTGATGGGGTGGAAAATGAAACG
JMSF024O03+ TTGGACTGCTCCGGGAACGCCGGAATCGTTGCGGGCGTTGATGGGGTGGAAAATGAAACG
                      ____________________________________________________________
consensus TTGGACTGCTCCGGGAACGCCGGAATCGTTGCGGGCGTTGATGGGGTGGAAAATGAAACG
 
. : . : . : . : . : . :
JMSF049D10+ GGTTCTGGATCGGGCAAATCCGGATTGGCAATCGAAACCGGTATGCATAAGCTGGCAAGT
JMSF023P05+ GGTTCTGGATCGGGCAAATCCGGATTGGCAATCGAAACCGGTATGCATAAGCTGGCAAGT
JMSF024O03+ GGTTCTGGATCGGGCAAATCCGGATTGGCAATCGAAACCGGTATGCATAAGCTGGCAAGT
                      ____________________________________________________________
consensus GGTTCTGGATCGGGCAAATCCGGATTGGCAATCGAAACCGGTATGCATAAGCTGGCAAGT
 
. : . : . : . : . : . :
JMSF049D10+ GAAAGGAAAGTGAAGGAGAGAAAGAAAACAGAGGAGTGGAACATTGCTTTGAGAGTGAGA
JMSF023P05+ GAAAGGAAAGTGAAGGAGAGAAAGAAAACAGAGGAGTGGAACATTGCTTTGAGAGTGAGA
JMSF024O03+ GAAAGGAAAGTGAAGGAGAGAAAGAAAACAGAGGAGTGGAACATTGCTTTGAGAGTGAGA
                      ____________________________________________________________
consensus GAAAGGAAAGTGAAGGAGAGAAAGAAAACAGAGGAGTGGAACATTGCTTTGAGAGTGAGA
 
. : . : . : . : . : . :
JMSF049D10+ GAAGTGGGAATTAAGTTCTCTTTTCCAATTTGGCTAAGAGAAAAAGGAGAAATGGAGAGA
JMSF023P05+ GAAGTGGGAATTAAGTTCTCTTTTCCAATTTGGCTAAGAGAAAAAGGAGAAATGG
JMSF024O03+ GAAGTGGGAATTAAGTTCTCTTTTCCAATTTGGCTAAGAGAAAAAGGAGAAATGGAGAGA
                      ____________________________________________________________
consensus GAAGTGGGAATTAAGTTCTCTTTTCCAATTTGGCTAAGAGAAAAAGGAGAAATGGAGAGA
 
. : . : . : . : . : . :
JMSF049D10+ AGTTGATAGTAAGTTGAGTTGGATATATGGCTTTAATGCATTGCTATTTGCCATTTG
JMSF024O03+ AGTTGATAGTAAGTTGAGTTGGATATATGGCTTTAATGCATTGCTATTTGCCATTTGCTC
                      ____________________________________________________________
consensus AGTTGATAGTAAGTTGAGTTGGATATATGGCTTTAATGCATTGCTATTTGCCATTTGCTC