Previous Contig 006250:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS160H04Sequence554006250 (2)pir|T07901|T079013e-38acyl CoA oxidase homolog - cucurbit>gb:AF002016_1760560 Cucurbita sp. cv. Kuroka
JMSF024N22Sequence659006250 (2)pir|T52120|T521203e-48acyl-CoA oxidase (EC 1.3.3.6), peroxisomal [validated] - Arabidopsis thaliana>gb803011475 (3)gb:AF202987_1776546e-103Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024N22+ TTCTTAGNTCCCAGATTGAGAACAGAGCCTCCCCAGAGACTGTACTGAACACCCATTTT
                      ____________________________________________________________
consensus TTCTTAGNTCCCAGATTGAGAACAGAGCCTCCCCAGAGACTGTACTGAACACCCATTTT
 
. : . : . : . : . : . :
JMFS160H04+ GATGGCAAGAGATACGTCAACGGCCCCAACAGCCTCCACAATAGCGAAATACTTACTAGG
JMSF024N22+ GATGGCAAGAGATACGTCAACGGCCCCAACAGCCTCCACAATAGCGAAATACTTACTAGG
                      ____________________________________________________________
consensus GATGGCAAGAGATACGTCAACGGCCCCAACAGCCTCCACAATAGCGAAATACTTACTAGG
 
. : . : . : . : . : . :
JMFS160H04+ CTCCTCCACCACGTACCTGAGCGGCCTTACCCCGGCCTCCCGGACCAGACCAGAGAGCTG
JMSF024N22+ CTCCTCCACCACGTACCTGAGCGGCCTTACCCCGGCCTCCCGGACCAGACCAGAGAGCTG
                      ____________________________________________________________
consensus CTCCTCCACCACGTACCTGAGCGGCCTTACCCCGGCCTCCCGGACCAGACCAGAGAGCTG
 
. : . : . : . : . : . :
JMFS160H04+ TCTCATGCACAATTCCCGGTGCTCATCCTTCAGAATATCCAGCGGCGTCTGCAGGCCCGG
JMSF024N22+ TCTCATGCACAATTCCCGGTGCTCATCCTTCAGAATATCCAGCGGCGTCTGCAGGCCCGG
                      ____________________________________________________________
consensus TCTCATGCACAATTCCCGGTGCTCATCCTTCAGAATATCCAGCGGCGTCTGCAGGCCCGG
 
. : . : . : . : . : . :
JMFS160H04+ CCTGGAGCTGAAGTACTCGTACACCTTCTCCTGCAACTCCCTGTGCTCCCCCCTCAGGTA
JMSF024N22+ CCTGGAGCTGAAGTACTCGTACACCTTCTCCTGCAACTCCCTGTGCTCCCCCCTCAGGTA
                      ____________________________________________________________
consensus CCTGGAGCTGAAGTACTCGTACACCTTCTCCTGCAACTCCCTGTGCTCCCCCCTCAGGTA
 
. : . : . : . : . : . :
JMFS160H04+ CACCGACAACTCCTTGGTATTCACCGTCAGAACCTTCGCCCTAGCGGCACACGTCAGCAT
JMSF024N22+ CACCGACAACTCCTTGGTATTCACCGTCAGAACCTTCGCCCTAGCGGCACACGTCAGCAT
                      ____________________________________________________________
consensus CACCGACAACTCCTTGGTATTCACCGTCAGAACCTTCGCCCTAGCGGCACACGTCAGCAT
 
. : . : . : . : . : . :
JMFS160H04+ CTCCAGGCGGCTGTCCGCGGAGTTGTCCAGGAACGTCGCCGGCGTGAGGTGCATTGACAG
JMSF024N22+ CTCCAGGCGGCTGTCCGCGGAGTTGTCCAGGAACGTCGCCGGCGTGAGGTGCATTGACAG
                      ____________________________________________________________
consensus CTCCAGGCGGCTGTCCGCGGAGTTGTCCAGGAACGTCGCCGGCGTGAGGTGCATTGACAG
 
. : . : . : . : . : . :
JMFS160H04+ CCGTCGGATGCGGCGGTTAATCAGTTGCGTCTCCTCCCGATTTTCGTCCTCCGCCGTGCG
JMSF024N22+ CCGTCGGATGCGGCGGTTAATCAGTTGCGTCTCCTCCCGATTTTCGCCCTCCGCCGTGCG
                      ____________________________________________________________
consensus CCGTCGGATGCGGCGGTTAATCAGTTGCGTCTCCTCCCGATTTTCGTCCTCCGCCGTGCG
 
. : . : . : . : . : . :
JMFS160H04+ ATTCAGACGTTGCGACGTCATCTTCCGATGATCCATAGCAGCGCTATGCATCTACCGAAC
JMSF024N22+ ATTCAGACGTTGCGACGTCATCTTCCGATGATCCATAGCAGCGCTATGCATCTACCGAAC
                      ____________________________________________________________
consensus ATTCAGACGTTGCGACGTCATCTTCCGATGATCCATAGCAGCGCTATGCATCTACCGAAC
 
. : . : . : . : . : . :
JMFS160H04+ AGAGTGGTGTGTACGGAATTATTGTACGGTTCCGCAGAGAGAAGTAGAGAAGCGATCGGA
JMSF024N22+ AGAGTGGTGTGTACGGAATTATTGTACGGTTCCGCAGAGAGAAGTAGAGAAGCGATCGGA
                      ____________________________________________________________
consensus AGAGTGGTGTGTACGGAATTATTGTACGGTTCCGCAGAGAGAAGTAGAGAAGCGATCGGA
 
. : . : . : . : . : . :
JMFS160H04+ GAAGAAGGAAGTGA
JMSF024N22+ GAAGAAGGAAGTGACTTTTACGGCAAATTAAATTGGATTAGTTGAAATGGAGAGATTAGA
                      ____________________________________________________________
consensus GAAGAAGGAAGTGACTTTTACGGCAAATTAAATTGGATTAGTTGAAATGGAGAGATTAGA