Previous Contig 006245:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024M14Sequence680006245 (2)625006245 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024M14+ GACGGGCACGATTCTTTTGT
JMSF024M14- GACGGGCACGATTCTTTTGT
                      ____________________________________________________________
consensus GACGGGCACGATTCTTTTGT
 
. : . : . : . : . : . :
rJMSF024M14+ TCTCGTCTGTCCGAGTATCGAAGGCTCTCCTTGCGTTGTAGGCTTCCTCGCTTCGCGCCG
JMSF024M14- TCTCGTCTGTCCGAGTATCGAAGGCTCTCCTTGCGTTGTAGGCTTCCTCGCTTCGCGCCG
                      ____________________________________________________________
consensus TCTCGTCTGTCCGAGTATCGAAGGCTCTCCTTGCGTTGTAGGCTTCCTCGCTTCGCGCCG
 
. : . : . : . : . : . :
rJMSF024M14+ TTTTCGTCGATTCTTCCTTCTATTTTCACTTCCACGTAGTGATGGTAATCAGTGGGGGCC
JMSF024M14- TTTTCGTCGATTCTTCCTTCTATTTTCACTTCCACGTAGTGATGGTAATCAGTGGGGGCC
                      ____________________________________________________________
consensus TTTTCGTCGATTCTTCCTTCTATTTTCACTTCCACGTAGTGATGGTAATCAGTGGGGGCC
 
. : . : . : . : . : . :
rJMSF024M14+ GTGGCTTATCAAAGAGGCGGTGACCACCGGAGAAAGATGTCGGGCGAGGGAGTGTTTAAA
JMSF024M14- GTGGCTTATCAAAGAGGCGGTGACCACCGGAGAAAGATGTCGGGCGAGGGAGTGTTTAAA
                      ____________________________________________________________
consensus GTGGCTTATCAAAGAGGCGGTGACCACCGGAGAAAGATGTCGGGCGAGGGAGTGTTTAAA
 
. : . : . : . : . : . :
rJMSF024M14+ AGGGAATGTGGTTACTAAGACCACGGTGTCGGGTGGCCCGGTTTGTGCGCCCCCGGTTAA
JMSF024M14- AGGGAATGTGGTTACTAAGACCACGGTGTCGGGTGGCCCGGTTTGTGCGCCCCCGGTTAA
                      ____________________________________________________________
consensus AGGGAATGTGGTTACTAAGACCACGGTGTCGGGTGGCCCGGTTTGTGCGCCCCCGGTTAA
 
. : . : . : . : . : . :
rJMSF024M14+ AGCGGTGCGTCCCGTTAAGCCTTCTGGAGTTTCTATCCCCGTTGTTGCTGCTCGGCTTCA
JMSF024M14- AGCGGTGCGTCCCGTTAAGCCTTCTGGAGTTTCTATCCCCGTTGTTGCTGCTCGGCTTCA
                      ____________________________________________________________
consensus AGCGGTGCGTCCCGTTAAGCCTTCTGGAGTTTCTATCCCCGTTGTTGCTGCTCGGCTTCA
 
. : . : . : . : . : . :
rJMSF024M14+ TTATCAACCGTCCGGCACTTGTGAATCAGTTGTGTTTCCCATGCCTGACCTTCTGGAGGA
JMSF024M14- TTATCAACCGTCCGGCACTTGTGAATCAGTTGTGTTTCCCATGCCTGACCTTCTGGAGGA
                      ____________________________________________________________
consensus TTATCAACCGTCCGGCACTTGTGAATCAGTTGTGTTTCCCATGCCTGACCTTCTGGAGGA
 
. : . : . : . : . : . :
rJMSF024M14+ TGCTTTGATAGTTAACTGGTTGTTGGGGGGAAACATGTTAGTATAGTGGTTTTCTTTGTT
JMSF024M14- TGCTTTGATAGTTAACTGGTTGTTGGGGGGAAACATGTTAGTATAGTGGTTTTCTTTGTT
                      ____________________________________________________________
consensus TGCTTTGATAGTTAACTGGTTGTTGGGGGGAAACATGTTAGTATAGTGGTTTTCTTTGTT
 
. : . : . : . : . : . :
rJMSF024M14+ ATCGTGGGTTGCATTCTGTATTTAGTTACGTCTGTTTTGGGTTTTTGCTATTGTGTGCAC
JMSF024M14- ATCGTGGGTTGCATTCTGTATTTAGTTACGTCTGTTTTGGGTTTTTGCTATTGTGTGCAC
                      ____________________________________________________________
consensus ATCGTGGGTTGCATTCTGTATTTAGTTACGTCTGTTTTGGGTTTTTGCTATTGTGTGCAC
 
. : . : . : . : . : . :
rJMSF024M14+ ACGTATATTGCAAACTATGCTCACTATAGTTTTTGGTCATACTACCTTTGTGCATACAGA
JMSF024M14- ACGTATATTGCAAACTATGCTCACTATAGTTTTTGGTCATACTACCTTTGTGCATACAGA
                      ____________________________________________________________
consensus ACGTATATTGCAAACTATGCTCACTATAGTTTTTGGTCATACTACCTTTGTGCATACAGA
 
. : . : . : . : . : . :
rJMSF024M14+ TACGTTTGTTTGTGCACAATCTTCTTGTGCACATTTTACTTGTTGATGCTACTGTAACGT
JMSF024M14- TACGTTTGTTTGTGCACAATCTTCTTGTGCACATTTTACTTGTTGATGCTACTGTAACGT
                      ____________________________________________________________
consensus TACGTTTGTTTGTGCACAATCTTCTTGTGCACATTTTACTTGTTGATGCTACTGTAACGT
 
. : . : . : . : . : . :
rJMSF024M14+ CACAC
JMSF024M14- CACACAAGCAGTGTTTAATTAATGCTAACGTTATTTTTGGGTTGGATGGTAAAAAAAAAA
                      ____________________________________________________________
consensus CACACAAGCAGTGTTTAATTAATGCTAACGTTATTTTTGGGTTGGATGGTAAAAAAAAAA