Previous Contig 006244:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS093D09Sequence609006244 (2)pir|T02368|T023681e-52hypothetical protein T8F5.23 - Arabidopsis thaliana>gb:AE005173_894198 Arabidops
JMSF024M09Sequence647006244 (2)pir|T02368|T023681e-56hypothetical protein T8F5.23 - Arabidopsis thaliana>gb:AE005173_894198 Arabidops690012378 (2)gb:AY085709_15707762e-69Arabidopsis thaliana clone 17230 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS093D09+ CTAGAAACATCTTANAGCCGCTTCC
JMSF024M09+ AAGGATAGAGCCGCCAGATTTTCTAGAAACATCTTAAAGCCGCTTCC
                      ____________________________________________________________
consensus AAGGATAGAGCCGCCAGATTTTCTAGAAACATCTTAAAGCCGCTTCC
 
. : . : . : . : . : . :
JMFS093D09+ GTCGAAGGAAATGTGATTCATCGATGTCCCCAAGGCAAAACCACCGCATTTAAACGACGT
JMSF024M09+ GTCGAAGGAAATGTGATTCATCGATGTCCCCAAGGCAAAACCACCGCATTTAAACGACGT
                      ____________________________________________________________
consensus GTCGAAGGAAATGTGATTCATCGATGTCCCCAAGGCAAAACCACCGCATTTAAACGACGT
 
. : . : . : . : . : . :
JMFS093D09+ CACCTGGAGGAAGCAAAACGGTTGATCCTCTTTAGCGACGAAATCAAAGCTCATCGTCAC
JMSF024M09+ CACCTGGAGGAAGCAAAGCGGTTGATCCTCTTTAGCGACGAAATCAAAGCTCATCGTCAC
                      ____________________________________________________________
consensus CACCTGGAGGAAGCAAAGCGGTTGATCCTCTTTAGCGACGAAATCAAAGCTCATCGTCAC
 
. : . : . : . : . : . :
JMFS093D09+ GAGTTGCCGGAATGCCGGGTTGGGATAAACCAAGTCGCCGATATCCTCCAGCGCAAACTC
JMSF024M09+ GAGTTGCCGGAATGCCGGGTTGGGATAAACCAAGTCGCCGATATCCTCCAGCGCAAACTC
                      ____________________________________________________________
consensus GAGTTGCCGGAATGCCGGGTTGGGATAAACCAAGTCGCCGATATCCTCCAGCGCAAACTC
 
. : . : . : . : . : . :
JMFS093D09+ ACTGGAAGCCACCGTAAACCCAGCCCCCGCCGCGTTGCACTCTATCTCCACCCGCTCCGA
JMSF024M09+ ACTGGAAGCCACCGTAAACCCAGCCCCCGCCGCGTTGCACTCTATCTCCACCCGCTCCGA
                      ____________________________________________________________
consensus ACTGGAAGCCACCGTAAACCCAGCCCCCGCCGCGTTGCACTCTATCTCCACCCGCTCCGA
 
. : . : . : . : . : . :
JMFS093D09+ CTCCTTATTCTTCTTAAGCCTCCCGGCCAAGAAATCATAAGTATTAGCGACTAACAACCT
JMSF024M09+ CTCCTTATTCTTCTTAAGCCTCCCGGCCAAGAAATCATAAGTATTAGCGACTAACAACCT
                      ____________________________________________________________
consensus CTCCTTATTCTTCTTAAGCCTCCCGGCCAAGAAATCATAAGTATTAGCGACTAACAACCT
 
. : . : . : . : . : . :
JMFS093D09+ CCGAAACGCATTCTTTATCTTTCCGGCCACAATCTCCGGCGGGAAACCTGGGCTTGCGGG
JMSF024M09+ CCGAAACGCATTCTTTATCTTTCCGGCCACAATCTCCGGCGGGAAACCTGGGCTTGCGGG
                      ____________________________________________________________
consensus CCGAAACGCATTCTTTATCTTTCCGGCCACAATCTCCGGCGGGAAACCTGGGCTTGCGGG
 
. : . : . : . : . : . :
JMFS093D09+ GAAGAAGTGAACAGTCTGCACATCAAAGTTAAGGACTTTGTCGATGTTGGACAAGAACAT
JMSF024M09+ GAAGAAGTGAACAGTCTGCACATCAAAGTTAAGGACTTTGTCGATGTTGGACAAGAACAT
                      ____________________________________________________________
consensus GAAGAAGTGAACAGTCTGCACATCAAAGTTAAGGACTTTGTCGATGTTGGACAAGAACAT
 
. : . : . : . : . : . :
JMFS093D09+ CGTATGTTTCGTGGTTTCCTGCGACGGAAATATGAGACCGGAGTCGAGGATTGTGACCTT
JMSF024M09+ CGTATGTTTCGTGGTTTCCTGCGACGGAAATATGAGACCGGAGTCGAGGATTGTGACCTT
                      ____________________________________________________________
consensus CGTATGTTTCGTGGTTTCCTGCGACGGAAATATGAGACCGGAGTCGAGGATTGTGACCTT
 
. : . : . : . : . : . :
JMFS093D09+ CAGGTCTTCATGCAGGGTCTCCGGTTTAAGATAGAGCGCTCCCATGATAGCTGTAAAGCT
JMSF024M09+ CAGGTCTTCATGCAGGGTCTCCGGTTTAAGATAGAGCGCTCCCATGATAGCTGTAAAGCT
                      ____________________________________________________________
consensus CAGGTCTTCATGCAGGGTCTCCGGTTTAAGATAGAGCGCTCCCATGATAGCTGTAAAGCT
 
. : . : . : . : . : . :
JMFS093D09+ GAGAAAACAAGAAAACCAGAATGAAATCAAACTAGTTTATGTTT
JMSF024M09+ GAGAAAACAAGAAAACCAGAATGAAATCAAACTAGTTTATGTTTTGTGTGGTGTGTGTTC
                      ____________________________________________________________
consensus GAGAAAACAAGAAAACCAGAATGAAATCAAACTAGTTTATGTTTTGTGTGGTGTGTGTTC