Previous Contig 006241:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042N02Sequence632006241 (2)gb:AY088357_15733776e-39Arabidopsis thaliana clone 6115 mRNA, complete sequence.586012376 (2)gb:BT002511_16361142e-24Arabidopsis thaliana expressed protein (At1g01500) mRNA, complete cds.>gb:BT0087
JMSF024M04Sequence670006241 (2)gb:AY088357_15733773e-37Arabidopsis thaliana clone 6115 mRNA, complete sequence.755012376 (2)gb:BT002511_16361149e-32Arabidopsis thaliana expressed protein (At1g01500) mRNA, complete cds.>gb:BT0087

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042N02+ CGGAACAGCATCCCGCTATGTAAACCTCGATCGAGGGTGAGCAAAAACTAAGCTTAGG
JMSF024M04+ TAAGCTTAGG
                      ____________________________________________________________
consensus CGGAACAGCATCCCGCTATGTAAACCTCGATCGAGGGTGAGCAAAAACTAAGCTTAGG
 
. : . : . : . : . : . :
JMFF042N02+ ATGAAAAAAGGACGATCCACCGGATACAAGGGAAGCCGCGGTGTAGCAATCCATGCTCCA
JMSF024M04+ ATGAAAAAAGGACGATCCACCGGATACAAGGGAAGCCGCGGTGTAGCAATCCATGCTCCA
                      ____________________________________________________________
consensus ATGAAAAAAGGACGATCCACCGGATACAAGGGAAGCCGCGGTGTAGCAATCCATGCTCCA
 
. : . : . : . : . : . :
JMFF042N02+ GCCAGTTCTGGAGGAATTCTCCGACCCATTCCCATTATTCCACGGCGTCTCCACCCTCTC
JMSF024M04+ GCCAGTTCTGGAGGAATTCTCCGACCCATTCCCATTATTCCACGGCGTCTCCACCCTCTC
                      ____________________________________________________________
consensus GCCAGTTCTGGAGGAATTCTCCGACCCATTCCCATTATTCCACGGCGTCTCCACCCTCTC
 
. : . : . : . : . : . :
JMFF042N02+ CAACGACCCACACAGAATCAACACATCTTTCATCTCCTGCACCTCAAATTCCACCGGCCC
JMSF024M04+ CAACGACCCACACAGAATCAACACATCTTTCATCTCCTGCACCTCAAATTCCACCGGCCC
                      ____________________________________________________________
consensus CAACGACCCACACAGAATCAACACATCTTTCATCTCCTGCACCTCAAATTCCACCGGCCC
 
. : . : . : . : . : . :
JMFF042N02+ GGAAACCCTGACGTTGTCGGTGCTCACGTAAGTTACCTCCGATGAATCCTNATCGGCGCG
JMSF024M04+ GGAAACCCTGACGTTGTCGGTGCTCACGTAAGTTACCTCCGATGAATCCTTATCGGCGCG
                      ____________________________________________________________
consensus GGAAACCCTGACGTTGTCGGTGCTCACGTAAGTTACCTCCGATGAATCCTTATCGGCGCG
 
. : . : . : . : . : . :
JMFF042N02+ ATCGAGGCGGAGCGTGATCGAGGCTGCATCGGAGGCAGGGAGGCGAGACCCGTTTATCTC
JMSF024M04+ ATCGAGGCGGAGCGTGATCGAGGCTGCATCGGAGGCAGGGAGGCGAGACCCGTTTATCTC
                      ____________________________________________________________
consensus ATCGAGGCGGAGCGTGATCGAGGCTGCATCGGAGGCAGGGAGGCGAGACCCGTTTATCTC
 
. : . : . : . : . : . :
JMFF042N02+ CAACCACACCCTTATCTCACGGCGGAGATGTCGGAGAATTAGGTGGTTTGGTACGGCGTC
JMSF024M04+ CAACCACACCCCCATCTCACGGCGGAGATGTCGGAGAATTAGGTGGTTTGGTACGGCGTC
                      ____________________________________________________________
consensus CAACCACACCCTTATCTCACGGCGGAGATGTCGGAGAATTAGGTGGTTTGGTACGGCGTC
 
. : . : . : . : . : . :
JMFF042N02+ AACTGTACAAGGAGCAATCCGTACGTAGAACAAACGTATCTCTAAGCAACCTCCCGTGAA
JMSF024M04+ AACTGTACAAGGAGCAATCCGTACGTAGAACAAACGTATCTCTAAGCAACCTCCCGTGAA
                      ____________________________________________________________
consensus AACTGTACAAGGAGCAATCCGTACGTAGAACAAACGTATCTCTAAGCAACCTCCCGTGAA
 
. : . : . : . : . : . :
JMFF042N02+ ATTCGAGCCTTTATAGATCCTCATCGGCACTTCCTCGTCTTGTTTGTCCATCTGAACCCC
JMSF024M04+ ATTCGAGCCTTTATAGATCCTCATCGGCACTTCCTCGTCTTGTTTGTCCATCTGAACCCC
                      ____________________________________________________________
consensus ATTCGAGCCTTTATAGATCCTCATCGGCACTTCCTCGTCTTGTTTGTCCATCTGAACCCC
 
. : . : . : . : . : . :
JMFF042N02+ AATTTTTAACGGCGAGGGATCAAATTAGGGCTTTTGCGGGAGAGAAGGAGAGAGGGTGAG
JMSF024M04+ AATTTTTAACGGCGAGGGATCAAATTAGGGCTTTTGCGGGAGAGAAGGAGAGAGGGTGAG
                      ____________________________________________________________
consensus AATTTTTAACGGCGAGGGATCAAATTAGGGCTTTTGCGGGAGAGAAGGAGAGAGGGTGAG
 
. : . : . : . : . : . :
JMFF042N02+ TTGGAATAGTGAAAAGGGGAGAGAGTTGAACATC
JMSF024M04+ TTGGAATAGTGAAAAGGGGAGAGAGTTGATCATCAGAGGAAAGAAGACGATGGCGAAATA
                      ____________________________________________________________
consensus TTGGAATAGTGAAAAGGGGAGAGAGTTGATCATCAGAGGAAAGAAGACGATGGCGAAATA
 
. : . : . : . : . : . :
JMSF024M04+ TTATGGCCAAGCGGAGCGTGAATTACACGCGTCGTTGCATTTAGACGGTGGCTCTAAACC
                      ____________________________________________________________
consensus TTATGGCCAAGCGGAGCGTGAATTACACGCGTCGTTGCATTTAGACGGTGGCTCTAAACC