Previous Contig 006240:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS010B07Sequence553006240 (11)gb:OSJN00138_16955181e-15Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc
JMFS033C10Sequence627006240 (11)gb:ATH510210_15528341e-40Arabidopsis thaliana ari7 gene for ARIADNE-like protein ARI7, exons 1-15.
JMFS033E08Sequence613006240 (11)gb:ATH510210_15528342e-34Arabidopsis thaliana ari7 gene for ARIADNE-like protein ARI7, exons 1-15.
JMFS038G07Sequence512006240 (11)gb:OSJN00138_16955181e-11Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc
JMFS054A03Sequence578006240 (11)gb:OSJN00138_16955181e-15Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc
JMFS082D01Sequence535006240 (11)gb:OSJN00138_16955185e-15Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc
JMFS109C01Sequence579006240 (11)gb:ATH510210_15528348e-36Arabidopsis thaliana ari7 gene for ARIADNE-like protein ARI7, exons 1-15.
JMFS128E07Sequence606006240 (11)gb:ATH510210_15528342e-33Arabidopsis thaliana ari7 gene for ARIADNE-like protein ARI7, exons 1-15.
JMFS154C07Sequence633006240 (11)gb:ATH510210_15528342e-41Arabidopsis thaliana ari7 gene for ARIADNE-like protein ARI7, exons 1-15.
JMFS154G10Sequence634006240 (11)gb:ATH510210_15528341e-42Arabidopsis thaliana ari7 gene for ARIADNE-like protein ARI7, exons 1-15.
JMSF024M02Sequence302006240 (11)727023137gb:AY087821_15728483e-04Arabidopsis thaliana clone 38640 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS109C01+ GGTT
JMFS154G10+ TCAATTGCGTCAAGATTAACGGCGATTTTGCAAGACGGGTCGGGGCACCGGAGGTT
JMFS033E08+ AGGTT
                      ____________________________________________________________
consensus TCAATTGCGTCAAGATTAACGGCGATTTTGCAAGACGGGTCGGGGCACCGGAGGTT
 
. : . : . : . : . : . :
JMFS109C01+ CAGGCAACCCGGCCCGTCCGCGACGGCGGTGCCGATGTAGCTACACCAACAATCAACACA
JMFS128E07+ CCGCGACGGCGGTGCCGATGTAGCTACACCAACAATCAACACA
JMFS154C07+ CCGCGACGGCGGTGCCGATGTAGCTACACCAACAATCAACACA
JMFS033C10+ CCGCGACGGCGGTGCCGATGTAGCTACACCAACAATCAACACA
JMFS154G10+ CAGGCAACCCGGCCCGTCCGCGACGGCGGTGCCGATGTAGCTACACCAACAATCAACACA
JMFS033E08+ CAGACAACCCGGCCCGTCCGCGACGGCGGTGCCGATGTAACTACACCAGCAATCAACACA
                      ____________________________________________________________
consensus CAGGCAACCCGGCCCGTCCGCGACGGCGGTGCCGATGTAGCTACACCAACAATCAACACA
 
. : . : . : . : . : . :
JMFS109C01+ AAAAGGGTGGCCACACGAGGCGGCGTAAACATTACCGGGAGAGTGATCATCGAAACAGAT
JMFS128E07+ AAAAGGGTGGCCACACGAGGCGGCGTAAACATTACCGGGAGAGTGATCATCGAAACAAAT
JMFS154C07+ AAAAGGGTGGCCACACGAGGCGGCGTAAACATTACCGGGAGAGTGATCATCGAAACAAAT
JMFS033C10+ AAAAGGGTGGCCACACGAGGCGGCGTAAACATTACCGGGAGAGTGATCATCGAAACAAAT
JMFS154G10+ AAAAGGGTGGCCACACGAGGCGGCGTAAACATTACCGGGAGAGTGATCATCGAAACAAAT
JMFS033E08+ AAAAGGGTGGCCACACGAGGCGGCGTAAACATTACCGGGCGAGTGATCATCGAAACAAAT
                      ____________________________________________________________
consensus AAAAGGGTGGCCACACGAGGCGGCGTAAACATTACCGGGAGAGTGATCATCGAAACAAAT
 
. : . : . : . : . : . :
JMFS109C01+ TCCGCAGCTGATTTCTCCACAATCCTCGATTCTTTTCTCCACACTCTGAGACGAAATCAG
JMFS128E07+ TCCGCAGCTGATTTCTCCACAATCCTCGATTCTTTTCTCCACACTCTGAGACGAAATCAG
JMFS154C07+ TCCGCAGCTGATTTCTCCACAATCCTCGATTCTTTTCTCCACACTCTGAGACGAAATCAG
JMFS033C10+ TCCGCAGCTGATTTCTCCACAATCCTCGATTCTTTTCTCCACACTCTGAGACGAAATCAG
JMFS154G10+ TCCGCAGCTGATTTCTCCACAATCCTCGATTCTTTTCTCCACACTCTGAGACGAAATCAG
JMFS033E08+ TCCACAGCTGATTTCTCCACAATCCTCGATTCTTTTCTCCACACTCTGAGACGAAATCAG
JMFS054A03+ CAATCCTCGATTCTTTTCTCCACACTCTGAGACGAAATCAG
JMFS010B07+ GAGACGAAATCAG
                      ____________________________________________________________
consensus TCCGCAGCTGATTTCTCCACAATCCTCGATTCTTTTCTCCACACTCTGAGACGAAATCAG
 
. : . : . : . : . : . :
JMFS109C01+ GCCCACCTCTTTCCGAACCCTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS128E07+ GCCCACCTCTTTCCGAACCCTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS154C07+ GCCCACCTCTTTCCGAACCCTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS033C10+ GCCCACCTCTTTCCGAACCCTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS154G10+ GCCCACCTCTTTCCGAACCCTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS033E08+ GCCCACCTCTTTCCGAACCGTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS054A03+ GCCCACCTCTTTCCGAACCGTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS082D01+ CCACCTCTTTCCGAACCGTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS038G07+ TCCGCGAACCACTCCTCGTGCACTCTGTTAAC
JMFS010B07+ GCCCACCTCTTTCCGAACCGTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
                      ____________________________________________________________
consensus GCCCACCTCTTTCCGAACCCTTTCCTCGTCCGCGAACCACTCCTCGTGCACTCTGTTAAC
 
. : . : . : . : . : . :
JMFS109C01+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS128E07+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS154C07+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS033C10+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS154G10+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS033E08+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS054A03+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS082D01+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS038G07+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
JMFS010B07+ GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
                      ____________________________________________________________
consensus GCTCCAATTGTAGCGGCGGAGAAGAGCGGAGGCCTCCGCCTTGGACACCGAGAGAACGGC
 
. : . : . : . : . : . :
JMFS109C01+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS128E07+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS154C07+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS033C10+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS154G10+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS033E08+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS054A03+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS082D01+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS038G07+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
JMFS010B07+ GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
                      ____________________________________________________________
consensus GGTGACTTGGGCTACATCGTCCTCCATGAGACGCCGGATTTCGTCCCCCGTCAAGATTGT
 
. : . : . : . : . : . :
JMFS109C01+ GAAATTACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS128E07+ GAAATTACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS154C07+ GAAATTACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS033C10+ GAAATTACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS154G10+ GAAATTACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS033E08+ GAAATCACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS054A03+ GAAATCACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS082D01+ GAAATCACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS038G07+ GAAATCACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
JMFS010B07+ GAAATCACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
                      ____________________________________________________________
consensus GAAATTACTCTCCTCGCCATGATCATCATCGCCGATGAAATCAGGATCCCCCTCCACATC
 
. : . : . : . : . : . :
JMFS109C01+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS128E07+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS154C07+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS033C10+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS154G10+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS033E08+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS054A03+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS082D01+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS038G07+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
JMFS010B07+ GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
                      ____________________________________________________________
consensus GCCATCGCTCCCGGAGTCTTCGTGGGTAACGTCGCCGTCACCGTCGCTGCCGCCGTAGAA
 
. : . : . : . : . : . :
JMFS109C01+ ATCATCGTCGCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCGGAGTCCATAGTGTT
JMFS128E07+ ATCATCGTCGCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCGGAGTCCATAGTGTT
JMFS154C07+ ATCATCGTCGCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCGGAGTCCATAGTGTT
JMFS033C10+ ATCATCGTCGCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCGGAGTCCATAGTGTT
JMFS154G10+ ATCATCGTCGCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCGGAGTCCATAGTGTT
JMFS033E08+ ATCATCGTCCCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCAGAGTCCATAGTGTT
JMFS054A03+ ATCATCGTCCCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCAGAGTCCATAGTGTT
JMFS082D01+ ATCATCGTCCCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCAGAGTCCATAGTGTT
JMFS038G07+ ATCATCGTCCCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCAGAGTCCATAGTGTT
JMFS010B07+ ATCATCGTCCCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCAGAGTCCATAGTGTT
JMSF024M02+ CCCGGCGAGCCCGTCTCNTCATATAAGCCATCGTCAGAGTCCATAGTGTT
                      ____________________________________________________________
consensus ATCATCGTCGCCCGGCGAGCCCGTCTCATCATATAAGCCATCGTCAGAGTCCATAGTGTT
 
. : . : . : . : . : . :
JMFS109C01+ AGTAGTAGAGTAGAATTTGTGTGGGGTCACAACAA
JMFS128E07+ AGTAGTAGAGTAGAATTTGTGTGGGGTCACAA
JMFS154C07+ AGT
JMFS033C10+ AGT
JMFS154G10+ AGTAGTAGAGTAGAATTTGTGTGGGGTCACAACAA
JMFS033E08+ AGT-GTAG---TGAATTTGT-TGGATTGTCGAGGTAAACCCCACTACTGACATTCGTGAG
JMFS054A03+ AGT-GTAG---TGAATTTGT-TGGATTGTCGAGGTAAACCCCACTACTGACATTCGTGAG
JMFS082D01+ AGT-GTAG---TGAATTTGT-TGGATTGTCGAGGTAAACCCCACTACTGACATTCGTGAG
JMFS038G07+ AGT-GTAG---TGAATTTGT-TGGATTGTCGAGGTAAACCCCACTACTGACATTCGTGAG
JMFS010B07+ AGT-GTAG---TGAATTTGT-TGGATTGTCGAGGTAAACCCCACTACTGACATTCGTGAG
JMSF024M02+ AGT-GTAG---NGAATTTGT-TGGATNGTCGAGGTAAACCCCACTANTGACANTCGTGAG
                      ____________________________________________________________
consensus AGT-GTAG---TGAATTTGT-TGGATTGTCGAGGTAAACCCCACTACTGACATTCGTGAG
 
. : . : . : . : . : . :
JMFS033E08+ TATGTGGGTAAAC
JMFS054A03+ TATGTGGGTAAACCCTCGCCTTGCGACCCTAGCCGGCAAAGAGCCACAAGGTGGTAAACC
JMFS082D01+ TATGTGGGTAAACCCTCGCCTTGCGACCCTAGCCGGCAAAGAGCCACAAGGTGGTAAACC
JMFS038G07+ TATGTGGGTAAACCCTCGCCTTGCGACCCTAGCCGGCAAAGAGCCACAAGGTGGTAAACC
JMFS010B07+ TATGTGGGTAAACCCTCGCCTTGCGACCCTAGCCGGCAAAGAGCCACAAGGTGGTAAACC
JMSF024M02+ TATGTGGGTAAACCCTCNCCNTGCGACCCTAGCCGGCAAAGAGCCACANGGNGGTAAACC
                      ____________________________________________________________
consensus TATGTGGGTAAACCCTCGCCTTGCGACCCTAGCCGGCAAAGAGCCACAAGGTGGTAAACC
 
. : . : . : . : . : . :
JMFS054A03+ AGCTTAAGTTTTTCATAGCTGACCGGCTCAAGGTGGGATCACAACAATGGAAGGGCAACA
JMFS082D01+ AGCTTAAGTTTTTCATAGCTGACCGGCTCAAGGTGGGATCACAACAATGGAAGGGCAACA
JMFS038G07+ AGCTTAAGTTTTTCATAGCTGACCGGCTCAAGGTGGGATCACAACAATGGAAGGGCAACA
JMFS010B07+ AGCTTAAGTTTTTCATAGCTGACCGGCTCAAGGTGGGATCACAACAATGGAAGGGCAACA
JMSF024M02+ AGCTTAAGTTTTTCATAGCTGNCCGGCTCAAGGTGGGATCNCANCANTGGAAGGGCANCA
                      ____________________________________________________________
consensus AGCTTAAGTTTTTCATAGCTGACCGGCTCAAGGTGGGATCACAACAATGGAAGGGCAACA
 
. : . : . : . : . : . :
JMFS054A03+ GA
JMFS082D01+ GA
JMFS038G07+ GA
JMFS010B07+ GA
JMSF024M02+ NACCGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAAATTAATAAAAACCCTC
                      ____________________________________________________________
consensus GACCGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAAATTAATAAAAACCCTC