Previous Contig 006234:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024K14Sequence314006234 (2)265006234 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024K14+ GAATCGAGACCCCT
JMSF024K14- GAATCGAGACCCCT
                      ____________________________________________________________
consensus GAATCGAGACCCCT
 
. : . : . : . : . : . :
rJMSF024K14+ CCTTAACTGCCCCAAAAAACACCTGTTTTTTCGTTCATTTGCTAATTCTGATGAGACATT
JMSF024K14- CCTTAACTGCCCCAAAAAACACCTGTTTTTTCGTTCATTTGCTAATTCTGATGAGACATT
                      ____________________________________________________________
consensus CCTTAACTGCCCCAAAAAACACCTGTTTTTTCGTTCATTTGCTAATTCTGATGAGACATT
 
. : . : . : . : . : . :
rJMSF024K14+ TCGGTTGCTGCTAAGGGCAGTGTAAGACTGTTTATCTATGTTGTTTTCTATACTTTCCTT
JMSF024K14- TCGGTTGCTGCTAAGGGCAGTGTAAGACTGTTTATCTATGTTGTTTTCTATACTTTCCTT
                      ____________________________________________________________
consensus TCGGTTGCTGCTAAGGGCAGTGTAAGACTGTTTATCTATGTTGTTTTCTATACTTTCCTT
 
. : . : . : . : . : . :
rJMSF024K14+ GATTAATCGGTTACTCTGATGTATCATTAATCGGTAGTCATAAACCAGACACATCCAGGT
JMSF024K14- GATTAATCGGTTACTCTGATGTATCATTAATCGGTAGTCATAAACCAGACACATCCAGGT
                      ____________________________________________________________
consensus GATTAATCGGTTACTCTGATGTATCATTAATCGGTAGTCATAAACCAGACACATCCAGGT
 
. : . : . : . : . : . :
rJMSF024K14+ ACACACTCTGGCTCATCTCTTAATCGTTTTGTTTTTGGGACATATTGGACTAGTATCTGC
JMSF024K14- ACACACTCTGGCTCATCTCTTAATCGTTTTGTTTTTGGGACATATTGGACTAGTATCTGC
                      ____________________________________________________________
consensus ACACACTCTGGCTCATCTCTTAATCGTTTTGTTTTTGGGACATATTGGACTAGTATCTGC
 
. : . : . : . : . : . :
rJMSF024K14+ ATCTTGTCGGA
JMSF024K14- ATCTTGTCGGATGAGACTAATATCCAATGTATATGTGTTTTATATTGTGCAAAAAAAAAA
                      ____________________________________________________________
consensus ATCTTGTCGGATGAGACTAATATCCAATGTATATGTGTTTTATATTGTGCAAAAAAAAAA