Previous Contig 006233:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN037I15Sequence545006233 (2)gb:AY084270_15693624e-37Arabidopsis thaliana clone 101865 mRNA, complete sequence.
JMSF024K13Sequence645006233 (2)gb:AY084270_15693621e-45Arabidopsis thaliana clone 101865 mRNA, complete sequence.740002092 (20)gb:AY364011_16028139e-80Daucus carota calmodulin 4 mRNA, partial cds.>gb:AY364012_1602814 Daucus carota

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024K13+ ATCGCCGGCATGGACTCGCACGCNTCCCACGTGCCAGCCCCCACG
                      ____________________________________________________________
consensus ATCGCCGGCATGGACTCGCACGCNTCCCACGTGCCAGCCCCCACG
 
. : . : . : . : . : . :
JMFN037I15+ GTCGCACGTGCCGCCGGCGACGACG
JMSF024K13+ TTGTAAATCTCCACCGCGAGGGGGTCGTCCTCGAAGTCGCACGTGCCGCCGGCGACGACG
                      ____________________________________________________________
consensus TTGTAAATCTCCACCGCGAGGGGGTCGTCCTCGAAGTCGCACGTGCCGCCGGCGACGACG
 
. : . : . : . : . : . :
JMFN037I15+ ATGTAGCCGCCCACGTGCGCCACGATGGGGTCCGTCCGCCACACCTTCGGCGCCTCGACG
JMSF024K13+ ATGTAGCCGCCCACGTGCGCCACGATGGGGTCCGTCCGCCACACCTTCGGCGCCTCGACG
                      ____________________________________________________________
consensus ATGTAGCCGCCCACGTGCGCCACGATGGGGTCCGTCCGCCACACCTTCGGCGCCTCGACG
 
. : . : . : . : . : . :
JMFN037I15+ TGGCGCCACGCGACGTTGAGCGCGTCGAAGGAAAACGAAAACGTCGTCGGGGACAACATG
JMSF024K13+ TGGCGCCACGCGACGTTGAGCGCGTCGAAGGAAAACGAAAACGTCGTCGGGGACAACATG
                      ____________________________________________________________
consensus TGGCGCCACGCGACGTTGAGCGCGTCGAAGGAAAACGAAAACGTCGTCGGGGACAACATG
 
. : . : . : . : . : . :
JMFN037I15+ TAAAGCAGGTTGGAGTGCGAGGAACGGAGGGCCGACACGTACTTGGCGGCCGGGTTCGAC
JMSF024K13+ TAAAGCAGGTTGGAGTGCGAGGAACGGAGGGCCGACACGTACTTGGCGGCCGGGTTCGAC
                      ____________________________________________________________
consensus TAAAGCAGGTTGGAGTGCGAGGAACGGAGGGCCGACACGTACTTGGCGGCCGGGTTCGAC
 
. : . : . : . : . : . :
JMFN037I15+ ACCTCCACCCACGCGCAAGAGCGATGGTCGTAGGCGCGTGTCGCCATCTCGTATGGCCAC
JMSF024K13+ ACCTCCACCCACGCGCAAGAGCGATGGTCGTAGGCGCGTGTCGCCATCTCGTATGGCCAC
                      ____________________________________________________________
consensus ACCTCCACCCACGCGCAAGAGCGATGGTCGTAGGCGCGTGTCGCCATCTCGTATGGCCAC
 
. : . : . : . : . : . :
JMFN037I15+ CGCGTGCTCTGCGTGTGAACCAACAACCACGGCTTCGGCTTGTTGAGCCACCGGAGAGAC
JMSF024K13+ CGCGTGCTCTGCGTGTGAACCAACAACCACGGCTTCGGCTTGTTGAGCCACCGGAGAGAC
                      ____________________________________________________________
consensus CGCGTGCTCTGCGTGTGAACCAACAACCACGGCTTCGGCTTGTTGAGCCACCGGAGAGAC
 
. : . : . : . : . : . :
JMFN037I15+ GCCGTCACGGCGGAGTTCCATGACTTTGACACAGCCGACGCCGGCACCAAATCCACAAGC
JMSF024K13+ GCCGTCACGGCGGAGTTCCATGACTTTGACACAGCCGACGCCGGCACCAAATCCACAAGC
                      ____________________________________________________________
consensus GCCGTCACGGCGGAGTTCCATGACTTTGACACAGCCGACGCCGGCACCAAATCCACAAGC
 
. : . : . : . : . : . :
JMFN037I15+ GGCACGTACGAAAGCACCACTTCCAAAATGTCACCGTGAATATGATCATTAGTCAAAGCC
JMSF024K13+ GGCACGTACGAAAGCACCACTTCCAAAATGTCACCGTGAATATGATCATTAGTCAAAGCC
                      ____________________________________________________________
consensus GGCACGTACGAAAGCACCACTTCCAAAATGTCACCGTGAATATGATCATTAGTCAAAGCC
 
. : . : . : . : . : . :
JMFN037I15+ ATTATACCCAACGAACCCAAATAATCTCTGATGGCTGATCGATTTTAAGGAAAGTGTGAA
JMSF024K13+ ATTATACACAACGAACCCAAATAATCTCTGATGGCTGATCGATTTTAAGGAAAGTGTGAA
                      ____________________________________________________________
consensus ATTATACCCAACGAACCCAAATAATCTCTGATGGCTGATCGATTTTAAGGAAAGTGTGAA
 
. : . : . : . : . : . :
JMFN037I15+ CGATTTGTAAATTGTAAATTTATTATAGGGTAATGGATAA
JMSF024K13+ CGATTTGTAAATTGTAAATTTATTATAGGGTAATGGATAATGAGAAACTCGACTACCCTC
                      ____________________________________________________________
consensus CGATTTGTAAATTGTAAATTTATTATAGGGTAATGGATAATGAGAAACTCGACTACCCTC