Previous Contig 006229:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015L10Sequence555006229 (5)gb:OSJN00071_16943014e-38Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019K04, complete seque769006229 (5)gb:AE016959_10235247e-75Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07
JMFN006L21Sequence637006229 (5)gb:AE016959_10235248e-60Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07
JMSF024J16Sequence649006229 (5)gb:OSJN00071_16943011e-47Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019K04, complete seque766006229 (5)gb:AE016959_10235247e-70Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024J16- TTAGCATAATCAAC
                      ____________________________________________________________
consensus TTAGCATAATCAAC
 
. : . : . : . : . : . :
rJMSF024J16- TAGCTTAACAACTCTTCAGTTTCACCTTTTATTTTATAACTTTTCAGATACTTTTCAACT
rJMFF015L10- CCTTTTATTTTATAACTTTTCAGATACTTTTCAACT
                      ____________________________________________________________
consensus TAGCTTAACAACTCTTCAGTTTCACCTTTTATTTTATAACTTTTCAGATACTTTTCAACT
 
. : . : . : . : . : . :
rJMSF024J16- AAGTTTACTAAACATAGCCAATGTAACTAATTACACGAAACGGGTGATGTTTCTTTTAAT
rJMFF015L10- AAGTTTACTAAACATAGCCAATGTAACTAATTACACGAAACGGGTGATGTTTCTTTTAAT
                      ____________________________________________________________
consensus AAGTTTACTAAACATAGCCAATGTAACTAATTACACGAAACGGGTGATGTTTCTTTTAAT
 
. : . : . : . : . : . :
rJMSF024J16- CGTTTTGAACCATGGTTCACAGTAAAATTTGCCGTTTTGCCATTAGTCGCTCAATCTGTG
rJMFF015L10- CGTTTTGAACCATGGTTCACAGTAAAATTTGCCGTTTTGCCATTAGTCGCTCAATCTGTG
                      ____________________________________________________________
consensus CGTTTTGAACCATGGTTCACAGTAAAATTTGCCGTTTTGCCATTAGTCGCTCAATCTGTG
 
. : . : . : . : . : . :
rJMSF024J16- AAAAACACGAACTTGTAATCCCCCGTCAATGTGAAGATTGATCATAGTCCTGTAGTTAAC
rJMFF015L10- AAAAACACGAACTTGTAATCCCCCGTCAATGTGAAGATTGATCATAGTCCTGTAGTTAAC
                      ____________________________________________________________
consensus AAAAACACGAACTTGTAATCCCCCGTCAATGTGAAGATTGATCATAGTCCTGTAGTTAAC
 
. : . : . : . : . : . :
rJMSF024J16- AGCTTTCCTTTCATCAGCCAGCTTGAAACCAAAGAACCGTAAAAGAACTGCAGAGAAGAT
rJMFF015L10- AGCTTTCCTTTCATCAGCCAGCTTGAAACCAAAGAACCGTAAAAGAACTGCAGAGAAGAT
                      ____________________________________________________________
consensus AGCTTTCCTTTCATCAGCCAGCTTGAAACCAAAGAACCGTAAAAGAACTGCAGAGAAGAT
 
. : . : . : . : . : . :
rJMSF024J16- CTTCATTTGCCTGTACGCAAACTCCTTTCCCAGACATATCCGCGGCCCAGCCTGAAAAGC
rJMFF015L10- CTTCATTTGCCTGTACGCAAACTCCTTTCCCAGACATATCCGCGGCCCAGCCTGAAAAGC
                      ____________________________________________________________
consensus CTTCATTTGCCTGTACGCAAACTCCTTTCCCAGACATATCCGCGGCCCAGCCTGAAAAGC
 
. : . : . : . : . : . :
rJMSF024J16- TGTCAATTTGAAGGGGCTCTCAGGCCTGAAACAGCCATTCTCGTCTAGCCATCTCTCGGG
rJMFF015L10- TGTCAATTTGAAGGGGCTCTCAGGCCTGAAACAGCCATTCTCGTCTAGCCATCTCTCGGG
                      ____________________________________________________________
consensus TGTCAATTTGAAGGGGCTCTCAGGCCTGAAACAGCCATTCTCGTCTAGCCATCTCTCGGG
 
. : . : . : . : . : . :
rJMSF024J16- CTTAAATTCTTCTGCATCATCGCCCCATATAAACCGCATTCTCCCCATTGCATATGGTTG
rJMFF015L10- CTTAAATTCTTCTGCATCATCGCCCCATATAAACCGCATTCTCCCCATTGCATATGGTTG
                      ____________________________________________________________
consensus CTTAAATTCTTCTGCATCATCGCCCCATATAAACCGCATTCTCCCCATTGCATATGGTTG
 
. : . : . : . : . : . :
rJMSF024J16- GTAAGCCACCATATCACCTTTCTTCACACTAAACCCATCCGGTAACGTGTCGTCTGAAAA
rJMFF015L10- GTAAGCCACCATATCACCTTTCTTCACACTAAACCCATCCGGTAACGTGTCGTCTGAAAA
JMFN006L21+ TCACACTAAACCCATCCGGTAACGTGTCGTCTGAAAA
                      ____________________________________________________________
consensus GTAAGCCACCATATCACCTTTCTTCACACTAAACCCATCCGGTAACGTGTCGTCTGAAAA
 
. : . : . : . : . : . :
rJMSF024J16- ACTTATTTTTGCATCCACAGGAACTGCAGGATAAAGCCTGAGAGTCTCAGTCAATGCAGC
rJMFF015L10- ACTTATTTTTGCATCCACAGGAACTGCAGGATAAAGCCTGAGAGTCTCAGTCAATGCAGC
JMFN006L21+ ACTTATTTTTGCATCCACAGGAACTGCAGGATAAAGCCTGAGAGTCTCAGTCAATGCAGC
                      ____________________________________________________________
consensus ACTTATTTTTGCATCCACAGGAACTGCAGGATAAAGCCTGAGAGTCTCAGTCAATGCAGC
 
. : . : . : . : . : . :
rJMSF024J16- ATGAAGGTATGGCATATTCTCCAGGGCTTCTTCTCTCAAATTGGCAGCAAAATGAGCAAA
rJMFF015L10- ATGAAGGTATGGCATATTCTCCAGGGCTTCTTCTCTCAAATTGGCAGCAAAATGAGCAAA
JMFN006L21+ ATGAAGGTATGGCATATTCTCCAGGGCTTCTTCTCTCAAATTGGCAGCAAAATGAGCAAA
                      ____________________________________________________________
consensus ATGAAGGTATGGCATATTCTCCAGGGCTTCTTCTCTCAAATTGGCAGCAAAATGAGCAAA
 
. : . : . : . : . : . :
rJMSF024J16- GTTTCTTGCATCTGCCGTCTTTGTTGCTTCTTGTATCTCTNGCACGATTTTTTCCTGTAC
rJMFF015L10- GTTTCTTGCATCTGCCGTCTTTGTTGCTTCTTGTATCTCTTGCACGATTTTTTCCTGTAC
JMFN006L21+ GTTTCTTGCATCTGCCGTCTTTGTTGCTTCTTGTATCTCTTGCACGATTTTTTCCTGTAC
                      ____________________________________________________________
consensus GTTTCTTGCATCTGCCGTCTTTGTTGCTTCTTGTATCTCTTGCACGATTTTTTCCTGTAC
 
. : . : . : . : . : . :
rJMSF024J16- GAGTGGATGCTTGCAAAGCATATATATAAACC
rJMFF015L10- GAGTGGATGCTTGCAAAGCATATATATAAACCAGGCTAGAGTTACTGCTGGTGTGTCTTT
JMFN006L21+ GAGTGGATGCTTGCAAAGCATATATATAAACCAGGCTAGAGTTACTGCTGTTGTGTCTTT
                      ____________________________________________________________
consensus GAGTGGATGCTTGCAAAGCATATATATAAACCAGGCTAGAGTTACTGCTGTTGTGTCTTT
 
. : . : . : . : . : . :
rJMFF015L10- GCC
JMFN006L21+ GCCAGCAATTACAAAGTTCAGTATTATATCTCGCAAGTACTTTGGTTCTGTCTCAGTCAA
                      ____________________________________________________________
consensus GCCAGCAATTACAAAGTTCAGTATTATATCTCGCAAGTACTTTGGTTCTGTCTCAGTCAA
 
. : . : . : . : . : . :
JMFN006L21+ CTGTAGAAACCTCGATAAAATGTCTTCTTTCTTCCAGCTCAATGAGGAATCATCCCGGGC
                      ____________________________________________________________
consensus CTGTAGAAACCTCGATAAAATGTCTTCTTTCTTCCAGCTCAATGAGGAATCATCCCGGGC
 
. : . : . : . : . : . :
JMFN006L21+ ATTATGCATTTGCTCGATCTTGCTTTGAATTAGCTTGAACACGAAGTCATTAACGATTTG
                      ____________________________________________________________
consensus ATTATGCATTTGCTCGATCTTGCTTTGAATTAGCTTGAACACGAAGTCATTAACGATTTG
 
. : . : . : . : . : . :
JMFN006L21+ GATACTTTTCTTTAACTTGGCTTCTGACCCAATATTGAGAGCCTTTTTGAGCTTCCAAAA
                      ____________________________________________________________
consensus GATACTTTTCTTTAACTTGGCTTCTGACCCAATATTGAGAGCCTTTTTGAGCTTCCAAAA
 
. : . : . : . : . : . :
JMFN006L21+ GATATCAACATATCTCCAAAGTGTCATTGCACTTGCATCATCAAACGCGGCGTTGAACTT
                      ____________________________________________________________
consensus GATATCAACATATCTCCAAAGTGTCATTGCACTTGCATCATCAAACGCGGCGTTGAACTT
 
. : . : . : . : . : . :
JMFN006L21+ GGCGCCTTCTTCACTCGAACCACACATGCTATCCAGTTCAACTCCAAACGCAACTCTAAA
JMSF024J16+ CACTCGAACCACACATGCTATCCAGTTCAACTCCAAACGCAACTCTAAA
                      ____________________________________________________________
consensus GGCGCCTTCTTCACTCGAACCACACATGCTATCCAGTTCAACTCCAAACGCAACTCTAAA
 
. : . : . : . : . : . :
JMFF015L10+ AACTGTGTTCTTGAAATC
JMSF024J16+ TATCGAGTCTAAAGTCGATTTCATGAACAAATCATGGATATCAACTGTGTTCTTGAAATC
                      ____________________________________________________________
consensus TATCGAGTCTAAAGTCGATTTCATGAACAAATCATGGATATCAACTGTGTTCTTGAAATC
 
. : . : . : . : . : . :
JMFF015L10+ TGCAACTTTAGACAAAATGTTAGCAAGCTTCACAACGTTTCTTCTAAAGATCACACTGCT
JMSF024J16+ TGCAACTTTAGACAAAATGTTAGCAAGCTTCACAACGTTTCTTCTAAAGATCACACTGCT
                      ____________________________________________________________
consensus TGCAACTTTAGACAAAATGTTAGCAAGCTTCACAACGTTTCTTCTAAAGATCACACTGCT
 
. : . : . : . : . : . :
JMFF015L10+ AAAATCTCTTAACACTCTTGTAGAAAACTCGTGGCTCGATAACTTCCTCTGCTCTTTCCA
JMSF024J16+ AAAATCTCTTAACACTCTTGTAGAAAACTCGTGGCTCGATAACTTCCTCTGCTCTTTCCA
                      ____________________________________________________________
consensus AAAATCTCTTAACACTCTTGTAGAAAACTCGTGGCTCGATAACTTCCTCTGCTCTTTCCA
 
. : . : . : . : . : . :
JMFF015L10+ CTTAATACCATCAACTGCAAAAATCCCATCTCCTAACAAGTCCTTCAGAATGGTATAGTT
JMSF024J16+ CTTAATACCATCAACTGCAAAAATCCCATCTCCTAACAAGTCCTTCAGAATGGTATAGTT
                      ____________________________________________________________
consensus CTTAATACCATCAACTGCAAAAATCCCATCTCCTAACAAGTCCTTCAGAATGGTATAGTT
 
. : . : . : . : . : . :
JMFF015L10+ GTGACCCCCCTTGCCATAGTTGTCAAAGTTGGTTTTGAGAATATACTCAACGTTAACCGG
JMSF024J16+ GTGACCCCCCTTGCCATAGTTGTCAAAGTTGGTTTTGAGAATATACTCAACGTTAACCGG
                      ____________________________________________________________
consensus GTGACCCCCCTTGCCATAGTTGTCAAAGTTGGTTTTGAGAATATACTCAACGTTAACCGG
 
. : . : . : . : . : . :
JMFF015L10+ GTCGGAGGTATAAATCTCATTCCGGAAAGGGCTGATTAGCCGGTAAGTTCTGTACTTTCC
JMSF024J16+ GTCGGAGGTATAAATCTCATTCCGGAAAGGGCTGATTAGCCGGTAAGTTCTGTACTTTCC
                      ____________________________________________________________
consensus GTCGGAGGTATAAATCTCATTCCGGAAAGGGCTGATTAGCCGGTAAGTTCTGTACTTTCC
 
. : . : . : . : . : . :
JMFF015L10+ GGCGAGATCCGTCATGTAATGGTGCAGCCTATGGAAGTTGATCAGCTGGTGGAAAACAGT
JMSF024J16+ GGCGAGATCCGTCATGTAATGGTGCAGCCTATGGAAGTTGATCAGCTGGTGGAAAACAGT
                      ____________________________________________________________
consensus GGCGAGATCCGTCATGTAATGGTGCAGCCTATGGAAGTTGATCAGCTGGTGGAAAACAGT
 
. : . : . : . : . : . :
JMFF015L10+ GCCGCCAACCGGGTGGTATTTCTTCGCCGCCGTCTTCTTCCTCCCATCCTCGCCGCCCTG
JMSF024J16+ GCCGCCAACCGGGTGGTATTTCTTCGCCGCCGTCTTCTTCCTCCCATCCTCGCCGCCCTG
                      ____________________________________________________________
consensus GCCGCCAACCGGGTGGTATTTCTTCGCCGCCGTCTTCTTCCTCCCATCCTCGCCGCCCTG
 
. : . : . : . : . : . :
JMFF015L10+ CAACTTTCCGACCAGGAAGCGCAGCAAGGCTGCAGAAATAACGGCAACAGAAAGCAAGGC
JMSF024J16+ CAACTTTCCGACCAGGAAGCGCAGCAAGGCTGCAGAAATAACGGCAACAGAAAGCAAGGC
                      ____________________________________________________________
consensus CAACTTTCCGACCAGGAAGCGCAGCAAGGCTGCAGAAATAACGGCAACAGAAAGCAAGGC
 
. : . : . : . : . : . :
JMFF015L10+ CACTGCAATGGAGATTTGAAGAGGTTCCAAGCCTGCAATCATGTTTAGGGGCATCTT
JMSF024J16+ CACTGCAATGGAGATTTGAAGAGGTTCCAAGCCTGCAATCATGTTTAGGGGCATCTTATC
                      ____________________________________________________________
consensus CACTGCAATGGAGATTTGAAGAGGTTCCAAGCCTGCAATCATGTTTAGGGGCATCTTATC