Previous Contig 006213:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036N23Sequence595006213 (4)gb:AY096642_15761808e-34Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672572014022 (7)gb:AY096642_15761806e-26Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672
JMSF003A01Sequence300006213 (4)gb:AY096642_15761806e-04Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672763022052gb:AY096642_15761804e-26Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672
JMSF024F21Sequence645006213 (4)gb:AY096642_15761802e-33Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672728023120gb:AY096642_15761805e-32Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672
JMSF052L03Sequence606006213 (4)gb:AY096642_15761803e-34Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672901014022 (7)gb:AY096642_15761801e-54Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052L03+ CTTGGCTGAC
JMSF024F21+ ACACGATCAAGAACTGACCCTTTCTTGCCTGACCCCTTGGCTGAT
                      ____________________________________________________________
consensus ACACGATCAAGAACTGACCCTTTCTTGCCTGACCCCTTGGCTGAT
 
. : . : . : . : . : . :
JMFF036N23+ TCAGCAATTGCAGGAAGGTGTATGGGGGCATAAAATTACTCACAAGCATTTCCAAGCATA
JMSF052L03+ TCAGCAATTGCAGGAAGGTGTATGGGGGCATAAAATTACTCACAAGCATTTCCAAGCATA
JMSF024F21+ TCAGCAATTGCAGGAAGGTATATGGAGGCATAAAATTACTCACGAGCATTTCCAAGCATA
                      ____________________________________________________________
consensus TCAGCAATTGCAGGAAGGTGTATGGGGGCATAAAATTACTCACAAGCATTTCCAAGCATA
 
. : . : . : . : . : . :
JMFF036N23+ AATCAATGTACTGCCCACTTGATGCTGCCAAGGATACAACTAGTTCCATCAGAGCATCCA
JMSF052L03+ AATCAATGTACTGCCCACTTGATGCTGCCAAGGATACAACTAGTTCCATCAGAGCATCCA
JMSF024F21+ AATCAATGTACTGCCCCCTTGATGCAGCCAAGGATACAACTAGTTCCATCAGAGCATCCA
                      ____________________________________________________________
consensus AATCAATGTACTGCCCACTTGATGCTGCCAAGGATACAACTAGTTCCATCAGAGCATCCA
 
. : . : . : . : . : . :
JMFF036N23+ TCACATCAGTCCCATAGTTCCACATGCTCATTCTAAATATAGAAGAAAGAAGAGATTTAT
JMSF052L03+ TCACATCAGTCCCATAGTTCCACATGCTCATTCTAAATATAGAAGAAAGAAGAGATTTAT
JMSF024F21+ TCACATCAGTCCCATAGTTCCACATGCTCATTTTTATTATAGAAGAAAGAAGAGATTGAT
                      ____________________________________________________________
consensus TCACATCAGTCCCATAGTTCCACATGCTCATTCTAAATATAGAAGAAAGAAGAGATTTAT
 
. : . : . : . : . : . :
JMFF036N23+ GATGAACAATGTCTATACAAGAGACAGCTCCTGACAAAGCCTTTAAACATGTCACAAGTA
JMSF052L03+ GATGAACAATGTCTATACAAGAGACAGCTCCTGACAAAGCCTTTAAACATGTCACAAGTA
JMSF024F21+ GATGAACAATGTCTATACAAGAGACAGCTCCTGACAAAGCCTTTAAACATGTCACAAGTA
                      ____________________________________________________________
consensus GATGAACAATGTCTATACAAGAGACAGCTCCTGACAAAGCCTTTAAACATGTCACAAGTA
 
. : . : . : . : . : . :
JMSF003A01+ TTGATCATGGTTTATAACTCCAACAAGCTGGGAAT
JMFF036N23+ AGGCCACCTCCTCAGGTGATAGATGTTGATCATGGTTTATAACTCCAACAAGCTGGGAAT
JMSF052L03+ AGGCCACCTCCTCAGGTGATAGATGTTGATCATGGTTTATAACTCCAACAAGCTGGGAAT
JMSF024F21+ AGGCCACCTCCTCAGGTAACAGGTATTGATCACGGTTTATAACTCCAACAAGCTGGGAAT
                      ____________________________________________________________
consensus AGGCCACCTCCTCAGGTGATAGATGTTGATCATGGTTTATAACTCCAACAAGCTGGGAAT
 
. : . : . : . : . : . :
JMSF003A01+ AATTGTCCATATCACCCTGGATAGCAGATTTAAGGGCATCCCTGACATGATAGAGCAGCT
JMFF036N23+ AATTGTCCATATCACCCTGGATAGCAGATTTAAGGGCATCCCTGACATGATAGAGCAGCT
JMSF052L03+ AATTGTCCATATCACCCTGGATAGCAGATTTAAGGGCATCCCTGACATGATAGAGCAGCT
JMSF024F21+ AATTGTCCAAATCACCCTGTATAGCAGATTTAAGGGCATCCCTGACATGATAGACCAGCT
                      ____________________________________________________________
consensus AATTGTCCATATCACCCTGGATAGCAGATTTAAGGGCATCCCTGACATGATAGAGCAGCT
 
. : . : . : . : . : . :
JMSF003A01+ CTGAATCAGAAAGGTCAACATTCTCAACCTCTGGCATGACTACCTGCTCAGCAGCTAATT
JMFF036N23+ CTGAATCAGAAAGGTCAACATTCTCAACCTCTGGCATGACTACCTGCTCAGCAGCTAATT
JMSF052L03+ CTGAATCAGAAAGGTCAACATTCTCAACCTCTGGCATGACTACCTGCTCAGCAGCTAATT
JMSF024F21+ CTGAATCAGAAAGGTCAACATTCTCAACCTCTGGCACGACACCCTGCTCAGCAGCTAACT
                      ____________________________________________________________
consensus CTGAATCAGAAAGGTCAACATTCTCAACCTCTGGCATGACTACCTGCTCAGCAGCTAATT
 
. : . : . : . : . : . :
JMSF003A01+ GCACTCCCATTTCTTCCAATATACGAATGACAATTAACTAAAACTCCAG
JMFF036N23+ GCACTCCCATTTCTTCCAATATACGAATGACAATTAACTAAAACTCCAG
JMSF052L03+ GCACTCCCATTTCTTCCAATATACGAATGACAATTAACTAAAACTCCAG
JMSF024F21+ GCACTCCCATTTCTTCCAATATATGAATGACAACTAACTAAAACCCCAGCAATGGATCGT
                      ____________________________________________________________
consensus GCACTCCCATTTCTTCCAATATACGAATGACAATTAACTAAAACTCCAGCAATGGATCGT
 
. : . : . : . : . : . :
JMSF024F21+ GTCTGTCCCGGTGTGCCGGGATAGGCTGCGAGGGAGAGGAGACCGGTTCCCGACGACGTC
                      ____________________________________________________________
consensus GTCTGTCCCGGTGTGCCGGGATAGGCTGCGAGGGAGAGGAGACCGGTTCCCGACGACGTC
 
. : . : . : . : . : . :
JMSF024F21+ TTGTAGAGTCGTAGTGAGGTAGCGAGCTACTGAGGATGTGAGGTGTGAGCTGCGAACCTC
                      ____________________________________________________________
consensus TTGTAGAGTCGTAGTGAGGTAGCGAGCTACTGAGGATGTGAGGTGTGAGCTGCGAACCTC