Previous Contig 006212:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS020F06Sequence625006212 (6)gb:AY091055_15742835e-46Arabidopsis thaliana unknown protein (At5g58510) mRNA, complete cds.>gb:AY117361
JMFS026H11Sequence622006212 (6)gb:AY091055_15742831e-50Arabidopsis thaliana unknown protein (At5g58510) mRNA, complete cds.>gb:AY117361
JMFS026H12Sequence615006212 (6)gb:AY091055_15742831e-48Arabidopsis thaliana unknown protein (At5g58510) mRNA, complete cds.>gb:AY117361
JMFS091E11Sequence626006212 (6)gb:AY091055_15742831e-45Arabidopsis thaliana unknown protein (At5g58510) mRNA, complete cds.>gb:AY117361
JMFS142H03Sequence625006212 (6)gb:AY091055_15742832e-49Arabidopsis thaliana unknown protein (At5g58510) mRNA, complete cds.>gb:AY117361
JMSF024F18Sequence704006212 (6)gb:AY091055_15742832e-58Arabidopsis thaliana unknown protein (At5g58510) mRNA, complete cds.>gb:AY117361705023119gb:AY091055_15742838e-56Arabidopsis thaliana unknown protein (At5g58510) mRNA, complete cds.>gb:AY117361

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024F18+ GTGATGGATCATGCACTGGAACAAAAGCGGGCCACAAACTGGAA
                      ____________________________________________________________
consensus GTGATGGATCATGCACTGGAACAAAAGCGGGCCACAAACTGGAA
 
. : . : . : . : . : . :
JMFS020F06+ AGCAACTGCACTTAATAGCTTGGTTGCCTCTGGTCTATCAAGA
JMFS091E11+ GCAACTGCACTTAATAGCTTGGTTGCCTCTGGTCTATCAAGA
JMFS142H03+ GTTCGACAATGCAATAGCAACTGCACTTAATAGCTTGGTGCCCTCTGGTCTATCAAGA
JMFS026H12+ GTTCGACAATGCAATAGCAACTGCACTTAATAGCTTGGTTGCCTCTGGTCTATCAAGA
JMFS026H11+ GTTCGACAATGCAATAGCAACTGCACTTAATAGCTTGGTTGCCTCTGGTCTATCAAGA
JMSF024F18+ CAGTTCGACAATGCAATAGCAACTGCACTTAATAGCTTGGTTGCCTCTGGTCTATCAAGA
                      ____________________________________________________________
consensus CAGTTCGACAATGCAATAGCAACTGCACTTAATAGCTTGGTTGCCTCTGGTCTATCAAGA
 
. : . : . : . : . : . :
JMFS020F06+ AGCACGCCACTTGCACTTTGTGGAGCAATCACCAGAAAGTCTTTCACCCCAAAGGAGAGC
JMFS091E11+ AGCACGCCACTTGCACTTTGTGGAGCAATCACCAGAAAGTCTTTCACCCCAAAGGAGAGC
JMFS142H03+ AGCACGCCACTTGCACTTTGTGGAGCAATCACCAGAAAGTCTTTCACCCCAAAGGAGAGC
JMFS026H12+ AGCACGCCACTTGCACTTTGTGGAGCAATCACCAGAAAGTCTTTCACCCCAAAGGAGAGC
JMFS026H11+ AGCACGCCACTTGCACTTTGTGGAGCAATCACCAGAAAGTCTTTCACCCCAAAGGAGAGC
JMSF024F18+ AGCACGCCACTTGCACTTTGTGGAGCAATCACCAGAAAGTCTTTCACCCCAAAGGAGAGC
                      ____________________________________________________________
consensus AGCACGCCACTTGCACTTTGTGGAGCAATCACCAGAAAGTCTTTCACCCCAAAGGAGAGC
 
. : . : . : . : . : . :
JMFS020F06+ TGCAAATCATGCAACTCATTAGTCCAATAACTCCAATCACTCATTTTTCCATCATTATTT
JMFS091E11+ TGCAAATCATGCAACTCATTAGTCCAATAACTCCAATCACTCATTTTTCCATCATTATTT
JMFS142H03+ TGCAAATCATGCAACTCATTAGTCCAATAACTCCAATCACTCATTTTTCCATCATTATTT
JMFS026H12+ TGCAAATCATGCAACTCATTAGTCCAATAACTCCAATCACTCATTTTTCCATCATTATTT
JMFS026H11+ TGCAAATCATGCAACTCATTAGTCCAATAACTCCAATCACTCATTTTTCCATCATTATTT
JMSF024F18+ TGCAAATCATGCAACTCATTAGTCCAATAACTCCAATCACTCATTTTTCCATCATTATTT
                      ____________________________________________________________
consensus TGCAAATCATGCAACTCATTAGTCCAATAACTCCAATCACTCATTTTTCCATCATTATTT
 
. : . : . : . : . : . :
JMFS020F06+ GTTTCAAAATAGTACTCCATCAAATAGCCTTTACTAGCATACTTAAGGTCAGATTTGACC
JMFS091E11+ GTTTCAAAATAGTACTCCATCAAATAGCCTTTACTAGCATACTTAAGGTCAGATTTGACC
JMFS142H03+ GTTTCAAAATAGTACTCCATCAAATAGCCTTTACTAGCATACTTAAGGTCAGATTTGACC
JMFS026H12+ GTTTCAAAATAGTACTCCATCAAATAGCCTTTACTAGCATACTTAAGGTCAGATTTGACC
JMFS026H11+ GTTTCAAAATAGTACTCCATCAAATAGCCTTTACTAGCATACTTAAGGTCAGATTTGACC
JMSF024F18+ GTTTCAAAATAGTACTCCATCAAATAGCCTTTACTAGCATACTTAAGGTCAGATTTGACC
                      ____________________________________________________________
consensus GTTTCAAAATAGTACTCCATCAAATAGCCTTTACTAGCATACTTAAGGTCAGATTTGACC
 
. : . : . : . : . : . :
JMFS020F06+ CTATAAAGGCCTTCAGGGGCATCCAAGCAGACAGCACCCTTCTTCAATAAATTTCTAGGG
JMFS091E11+ CTATAAAGGCCTTCAGGGGCATCCAAGCAGACAGCACCCTTCTTCAATAAATTTCTAGGG
JMFS142H03+ CTATAAAGGCCTTCAGGGGCATCCAAGCAGACAGCACCCTTCTTCAATAAATTTCTAGGG
JMFS026H12+ CTATAAAGGCCTTCAGGGGCATCCAAGCAGACAGCACCCTTCTTCAATAAATTTCTAGGG
JMFS026H11+ CTATAAAGGCCTTCAGGGGCATCCAAGCAGACAGCACCCTTCTTCAATAAATTTCTAGGG
JMSF024F18+ CTATAAAGGCCTTCAGGGGCATCCAAGCAGACAGCACCCTTCTTCAATAAATTTCTAGGG
                      ____________________________________________________________
consensus CTATAAAGGCCTTCAGGGGCATCCAAGCAGACAGCACCCTTCTTCAATAAATTTCTAGGG
 
. : . : . : . : . : . :
JMFS020F06+ CCATCTGCCAACCATTGCCTGCAAACTGCCTCTATCTCAGATATAAACCTTTCCCATGTA
JMFS091E11+ CCATCTGCCAACCATTGCCTGCAAACTGCCTCTATCTCAGATATAAACCTTTCCCATGTA
JMFS142H03+ CCATCTGCCAACCATTGCCTGCAAACTGCCTCTATCTCAGATATAAACCTTTCCCATGTA
JMFS026H12+ CCATCTGCCAACCATTGCCTGCAAACTGCCTCTATCTCAGATATAAACCTTTCCCATGTA
JMFS026H11+ CCATCTGCCAACCATTGCCTGCAAACTGCCTCTATCTCAGATATAAACCTTTCCCATGTA
JMSF024F18+ CCATCTGCCAACCATTGCCTGCAAACTGCCTCTATCTCAGATATAAACCTTTCCCATGTA
                      ____________________________________________________________
consensus CCATCTGCCAACCATTGCCTGCAAACTGCCTCTATCTCAGATATAAACCTTTCCCATGTA
 
. : . : . : . : . : . :
JMFS020F06+ GAAGCCAAAGTAAAATCATCAAAATGCTCAAACTCCTCTTCCTGATTATCGTCCTCTGGA
JMFS091E11+ GAAGCCAAAGTAAAATCATCAAAATGCTCAAACTCCTCTTCCTGATTATCGTCCTCTGGA
JMFS142H03+ GAAGCCAAAGTAAAATCATCAAAATGCTCAAACTCCTCTTCCTGATTATCGTCCTCTGGA
JMFS026H12+ GAAGCCAAAGTAAAATCATCAAAATGCTCAAACTCCTCTTCCTGATTATCGTCCTCTGGA
JMFS026H11+ GAAGCCAAAGTAAAATCATCAAAATGCTCAAACTCCTCTTCCTGATTATCGTCCTCTGGA
JMSF024F18+ GAAGCCAAAGTAAAATCATCAAAATGCTCAAACTCCTCTTCCTGATTATCGTCCTCTGGA
                      ____________________________________________________________
consensus GAAGCCAAAGTAAAATCATCAAAATGCTCAAACTCCTCTTCCTGATTATCGTCCTCTGGA
 
. : . : . : . : . : . :
JMFS020F06+ GGGGTCGGTCCTTTGCTTGTGGATGCCATGAAACCGCAGCGAAGCTCAAATTGAAACAAT
JMFS091E11+ GGGGTCGGTCCTTTGCTTGTGGATGCCATGAAACCGCAGCGAAGCTCAAATTGAAACAAT
JMFS142H03+ GGGGTCGGTCCTTTGCTTGTGGATGCCATGAAACCGCAGCGAAGCTCAAATTGAAACAAT
JMFS026H12+ GGGGTCGGTCCTTTGCTTGTGGATGCCATGAAACCGCAGCGAAGCTCAAATTGAAACAAT
JMFS026H11+ GGGGTCGGTCCTTTGCTTGTGGATGCCATGAAACCGCAGCGAAGCTCAAATTGAAACAAT
JMSF024F18+ GGGGTCGGTCCTTTGCTTGTGGATGCCATGAAACCGCAGCGAAGCTCAAATTGAAACAAT
                      ____________________________________________________________
consensus GGGGTCGGTCCTTTGCTTGTGGATGCCATGAAACCGCAGCGAAGCTCAAATTGAAACAAT
 
. : . : . : . : . : . :
JMFS020F06+ TGAAAGCAACAAATCGAACGATTCGGACATTACAGAATGCAGATATTTCTCGCGATCTGT
JMFS091E11+ TGAAAGCAACAAATCGAACGATTCGGACATTACAGAATGCAGATATTTCTCGCGATCTGT
JMFS142H03+ TGAAAGCAACAAATCGAACGATTCGGACATTACAGAATGCAGATATTTCTCGCGATCTGT
JMFS026H12+ TGAAAGCAACAAATCGAACGATTCGGACATTACAGAATGCAGATATTTCTCGCGATCTGT
JMFS026H11+ TGAAAGCAACAAATCGAACGATTCGGACATTACAGAATGCAGATATTTCTCGCGATCTGT
JMSF024F18+ TGAAAGCAACAAATCGAACGATTCGGACATTACAGAATGCAGATATTTCTCGCGATCTGT
                      ____________________________________________________________
consensus TGAAAGCAACAAATCGAACGATTCGGACATTACAGAATGCAGATATTTCTCGCGATCTGT
 
. : . : . : . : . : . :
JMFS020F06+ GAATCTATCGGGAGAGTGTTAAAAGGCGAGAAACGTCGAAGATCATAGATGCGTTGAGTT
JMFS091E11+ GAATCTATCGGGAGAGTGTTAAAAGGCGAGAAACGTCGAAGATCATAGATGCGTTGAGTT
JMFS142H03+ GAATCTATCGGGAGAGTGTTAAAAGGCGAGAAACGTCGAAGATCATAGATGCGTTGAGTT
JMFS026H12+ GAATCTATCGGGAGAGTGTTAAAAGGCGAGAAACGTCGAAGATCATAGATGCGTTGAGTT
JMFS026H11+ GAATCTATCGGGAGAGTGTTAAAAGGCGAGAAACGTCGAAGATCATAGATGCGTTGAGTT
JMSF024F18+ GAATCTATCGGGAGAGTGTTAAAAGGCGAGAAACGTCGAAGATCATAGATGCGTTGAGTT
                      ____________________________________________________________
consensus GAATCTATCGGGAGAGTGTTAAAAGGCGAGAAACGTCGAAGATCATAGATGCGTTGAGTT
 
. : . : . : . : . : . :
JMFS020F06+ CCGTCGACGGTGCGGTGACTGCGGTCTTAATGGGGCGGAAAT
JMFS091E11+ CCGTCGACGGTGCGGTGACTGCGGTCTTAATGGGGCGGAAAT
JMFS142H03+ CCGTCGACGGTGCGGTGACTGCGG
JMFS026H12+ CCGTCGACGGTG
JMFS026H11+ CCGTCGACGGTG
JMSF024F18+ CCGTCGACGGTGCGGTGACTGCGGTCTTAATGGGGCGGAAATGATGAGAAGTGAATAACC
                      ____________________________________________________________
consensus CCGTCGACGGTGCGGTGACTGCGGTCTTAATGGGGCGGAAATGATGAGAAGTGAATAACC