Previous Contig 006209:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030C23Sequence509006209 (4)pir|T04628|T046281e-10cytochrome P450 homolog F10M6.190 - Arabidopsis thaliana>gb:ATCHRIV76_1547138 Ar468006209 (4)sp|Q9SL42|PIN1_ARATH6e-09Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1)
JMFF044D05Sequence632006209 (4)gb:AP002484_18222323e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0489A01616010405 (2)pir|G96611|G966111e-21probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF024F08Sequence707006209 (4)gb:AP002484_18222321e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0489A01727010405 (2)pir|G96611|G966112e-42probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF030C23- ATGAAGTCAGGTAGTTGCCACGTTTAGCANAGCTGCAATCGGANAAGCAANATAT
                      ____________________________________________________________
consensus ATGAAGTCAGGTAGTTGCCACGTTTAGCANAGCTGCAATCGGANAAGCAANATAT
 
. : . : . : . : . : . :
rJMFF030C23- GACNTCCTCNAAGTTGGACTTGCCGGAAAGGATATCGTCNCGAGNGGNGTTGCAAATAAT
                      ____________________________________________________________
consensus GACNTCCTCNAAGTTGGACTTGCCGGAAAGGATATCGTCNCGAGNGGNGTTGCAAATAAT
 
. : . : . : . : . : . :
rJMFF030C23- ACGGNTCTCTGGGTCCTTCCAGGTCNCCTTGCGTCTGGAGCCCTGGNGTTTGACNACTTT
                      ____________________________________________________________
consensus ACGGNTCTCTGGGTCCTTCCAGGTCNCCTTGCGTCTGGAGCCCTGGNGTTTGACNACTTT
 
. : . : . : . : . : . :
rJMFF030C23- TTTCTGACNCCATCGATTTCAAAATCTGAGGAGGCGGCTAGGCTGCTCGTGCTGGAGGGT
                      ____________________________________________________________
consensus TTTCTGACNCCATCGATTTCAAAATCTGAGGAGGCGGCTAGGCTGCTCGTGCTGGAGGGT
 
. : . : . : . : . : . :
rJMFF030C23- GGGTGAGGGGATCTTTCTCGCAATTTACNCAAGCCTCAATGATATAAACNACNCCGCATT
                      ____________________________________________________________
consensus GGGTGAGGGGATCTTTCTCGCAATTTACNCAAGCCTCAATGATATAAACNACNCCGCATT
 
. : . : . : . : . : . :
rJMFF030C23- CNCCAAACTGCTCGNGCCGCTATTGCTCCTCTTGTTCCTCCGGCAACCGCCGCCAACGGG
JMFF030C23+ TCCGGCAACCGCCGCCAACGGG
                      ____________________________________________________________
consensus CNCCAAACTGCTCGNGCCGCTATTGCTCCTCTTGTTCCTCCGGCAACCGCCGCCAACGGG
 
. : . : . : . : . : . :
rJMFF030C23- GATGTTAAAAACCANCTTGTCTTGTTTGGCTAGGTTTTGTTTTAGTTGAAGGATATCGTT
JMFF030C23+ GATGTTAAAAACCAGCTTGTCTTGTTTGGCTAGGTTTTGTTTTAGTTGAAGGATATCGTT
                      ____________________________________________________________
consensus GATGTTAAAAACCAGCTTGTCTTGTTTGGCTAGGTTTTGTTTTAGTTGAAGGATATCGTT
 
. : . : . : . : . : . :
rJMFF030C23- GAGGATCTTTGCTTCAACTTGAGGGTTTTGNGCAAGGAGCAAAAAAAACCGAG
JMFF030C23+ GAGGATCTTTGCTTCAACTTGAGGGTTTTGTGCAAGGAGCAGAAAGAACCGAGTGCCGAA
                      ____________________________________________________________
consensus GAGGATCTTTGCTTCAACTTGAGGGTTTTGTGCAAGGAGCAGAAAGAACCGAGTGCCGAA
 
. : . : . : . : . : . :
JMFF030C23+ GCCGTGGTGTCTCCTCCGGCGATGATAAATGTCACAAAGATGTCTCTCAGAAACTGCATC
                      ____________________________________________________________
consensus GCCGTGGTGTCTCCTCCGGCGATGATAAATGTCACAAAGATGTCTCTCAGAAACTGCATC
 
. : . : . : . : . : . :
JMFF030C23+ GAATTTCCTCAGAGGGTTTTGATGTGTGACGTCAGCATGCCGGAGGAATCGTGTGGTTGC
                      ____________________________________________________________
consensus GAATTTCCTCAGAGGGTTTTGATGTGTGACGTCAGCATGCCGGAGGAATCGTGTGGTTGC
 
. : . : . : . : . : . :
JMFF030C23+ TACTGGGTTTTGTTGAGCTGTTCCGTCATCTCCTCAAGGATGGGATATATAAAGTTACTG
                      ____________________________________________________________
consensus TACTGGGTTTTGTTGAGCTGTTCCGTCATCTCCTCAAGGATGGGATATATAAAGTTACTG
 
. : . : . : . : . : . :
JMFF030C23+ AAACTTTGATCAGCTTGAGAAAGCTTTTTCTCTCTGTCAATCCCTCCACAAATCCAATAT
                      ____________________________________________________________
consensus AAACTTTGATCAGCTTGAGAAAGCTTTTTCTCTCTGTCAATCCCTCCACAAATCCAATAT
 
. : . : . : . : . : . :
JMFF030C23+ TTCTGCAGCTTCCAACACATTTCCCGGAGTATATTTCTGTAGAGAATAGCGATCACGCCA
JMSF024F08+ TTCCGGGAGTATCTCTCTGTAGAGAATAGCGTTCACGCCA
                      ____________________________________________________________
consensus TTCTGCAGCTTCCAACACATTTCCGGGAGTATCTTTCTGTAGAGAATAGCGTTCACGCCA
 
. : . : . : . : . : . :
JMFF030C23+ TCCCTGATCGCCTTCAGGAATGGATGGTCGCCGGTTGGGTCAATGCAAAGACTGCC
JMFF044D05+ CAGGAATGGATGTTCGCCGGTTGGGTCAACGCAAAGAGTGCCGGGA
JMSF024F08+ TCCCTGATCGCCTCCAGGATTGGATGGTCGCCGGTTGGGTCAACGCAAAGACTGCCCAGA
                      ____________________________________________________________
consensus TCCCTGATCGCCTTCAGGAATGGATGGTCGCCGGTTGGGTCAACGCAAAGACTGCCGGGA
 
. : . : . : . : . : . :
JMFF044D05+ TCCTTGTCCATAAACTGCTGACAGCTTATGTCGAACAAAATTCTATGGAAAATTTCTTGC
JMSF024F08+ TCCTTATCCAGAAACTGCTGAAAGCTTATGTCGAAAGAAATTCTATGGAAAATTTCCTGC
                      ____________________________________________________________
consensus TCCTTGTCCATAAACTGCTGACAGCTTATGTCGAACGAAATTCTATGGAAAATTTCTTGC
 
. : . : . : . : . : . :
JMFF044D05+ AGATCGATGTGGGTCCCTTGTTGAGCGTAATGGTCAAGAACCGGAAACAACCCATTCTCG
JMSF024F08+ AGATCGACGTGGGTTCCTTGTTGAGCGTAATGTTCAAGAACCGGAAACATCCCATTCTCC
                      ____________________________________________________________
consensus AGATCGATGTGGGTTCCTTGTTGAGCGTAATGTTCAAGAACCGGAAACATCCCATTCTCG
 
. : . : . : . : . : . :
JMFF044D05+ ATCTTCTGTGACACGTTCCTCTCCAAGGAAGTGCGGAAGTTGGCCTGGTTCATGAGCGGC
JMSF024F08+ ATCTTCTGCGACACGTTCCTCTCCAAGGAAGTGCGGAAGTTGTCATGGTTCATAAGCGGC
                      ____________________________________________________________
consensus ATCTTCTGTGACACGTTCCTCTCCAAGGAAGTGCGGAAGTTGTCCTGGTTCATGAGCGGC
 
. : . : . : . : . : . :
JMFF044D05+ GTCGTGGTCTTCCGGTGAAGCTCCCATAGCTCAGAGTCCACGTTTATCATCCCATCTCCG
JMSF024F08+ GTCGTGGTCTTCCGGTGAAGCTCCCATAGCTCCGAGTCCACGTTTATCATCCCATC-CCG
                      ____________________________________________________________
consensus GTCGTGGTCTTCCGGTGAAGCTCCCATAGCTCCGAGTCCACGTTTATCATCCCATCTCCG
 
. : . : . : . : . : . :
JMFF044D05+ AGGACGTGAAATATTTTCCGGAAACCAGGACCCTTCGGATAGTTCTCGAAGTTTCTGCAG
JMSF024F08+ AGGACGTGAAATATTTTCCGGAAACGAGGACCCTTGGGATAGTTCTGGAAGTTTCTGCAG
                      ____________________________________________________________
consensus AGGACGTGAAATATTTTCCGGAAACGAGGACCCTTGGGATAGTTCTGGAAGTTTCTGCAG
 
. : . : . : . : . : . :
JMFF044D05+ AGGATGTGATTGACGTTCGCAGGGTCGCAGGTGACAAGCATGTCCATGTTAGCAAACCAT
JMSF024F08+ AGGATGTGATTGACGTTAGCAGGGTCGCCGGTGACAAGCATGTCCCTGTTAGCAAACCAT
                      ____________________________________________________________
consensus AGGATGTGATTGACGTTCGCAGGGTCGCCGGTGACAAGCATGTCCCTGTTAGCAAACCAT
 
. : . : . : . : . : . :
JMFF044D05+ --ACCTTTGATCTCAATTGTCCCACCACTTTCTCGGAGAAGCTCTGTTGCATAATGGTGG
JMSF024F08+ GGACCTTTGATCTCAAATGTCCCACCACTTTCTCGGAGAAGCTCTGTTACATATTCGTGG
                      ____________________________________________________________
consensus GGACCTTTGATCTCAATTGTCCCACCACTTTCTCGGAGAAGCTCTGTTGCATATTGGTGG
 
. : . : . : . : . : . :
JMFF044D05+ ATGCGGCCGGCGTTTTGTAGGAGCGCCGGCAACATTCCGACGACAGGCCAATTCGTGGGA
JMSF024F08+ ATGCGGCCGGCGTTCTGTAGGAGCGCCGGCAACATTCCGACGACAGGCCAATTCGTGGGA
                      ____________________________________________________________
consensus ATGCGGCCGGCGTTTTGTAGGAGCGCCGGCAACATTCCGACGACAGGCCAATTCGTGGGA
 
. : . : . : . : . : . :
JMFF044D05+ AGTACGCTTCGGCGGCTGCGTTTCTTCCA
JMSF024F08+ AATACGCTTCGGCGGCTGCGTTTCTTCCAAATCTGCCGCGCCCATATCCAACACAAAATA
                      ____________________________________________________________
consensus AGTACGCTTCGGCGGCTGCGTTTCTTCCAAATCTGCCGCGCCCATATCCAACACAAAATA
 
. : . : . : . : . : . :
JMSF024F08+ CTACATAAAATAGCCACAACAACATAAGACTCTTTGAAGATTCTCATTGTATATCTGACC
                      ____________________________________________________________
consensus CTACATAAAATAGCCACAACAACATAAGACTCTTTGAAGATTCTCATTGTATATCTGACC