Previous Contig 006204:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043I15Sequence646006204 (3)gb:AY100638_15769455e-54Prunus cerasus putative sorbitol transporter (SorT2) mRNA, complete cds.633010322 (4)gb:BVU64903_16432311e-35Beta vulgaris putative sugar transporter (BvcDNA-397) mRNA, complete cds.
JMFF045D09Sequence635006204 (3)gb:AY100638_15769454e-40Prunus cerasus putative sorbitol transporter (SorT2) mRNA, complete cds.605010322 (4)gb:AP004365_18408286e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMSF024D22Sequence658006204 (3)755010322 (4)gb:BVU64903_16432313e-62Beta vulgaris putative sugar transporter (BvcDNA-397) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043I15+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMFF043I15+ CGCCGGAGAGGCCCAGCATGAGCCGCCAACTAATGTTCGCCGGCAGCCCGGATAACAAAA
                      ____________________________________________________________
consensus CGCCGGAGAGGCCCAGCATGAGCCGCCAACTAATGTTCGCCGGCAGCCCGGATAACAAAA
 
. : . : . : . : . : . :
JMFF043I15+ TGTTGGAAACGAAACCGATCAATATCCCGACGTTGATGAACACTTCCGGCAGCGAAGACA
JMFF045D09+ GAAGACA
                      ____________________________________________________________
consensus TGTTGGAAACGAAACCGATCAATATCCCGACGTTGATGAACACTTCCGGCAGCGAAGACA
 
. : . : . : . : . : . :
JMFF043I15+ GAAAGCCGCGGGTCATCGCCGGCGACAGCTCGCTAGTGTACACCGGAGCAATCATGAGGG
JMFF045D09+ GAAAGCCGCGGGTCATCGCCGGCGACAGCTCGCTAGTGTACACCGGAGCAATCATGAGGG
                      ____________________________________________________________
consensus GAAAGCCGCGGGTCATCGCCGGCGACAGCTCGCTAGTGTACACCGGAGCAATCATGAGGG
 
. : . : . : . : . : . :
JMFF043I15+ AATACCCCACTCCGATCCCGGCGACCACTCTTCCGGCCAGTAGATAGCCGTATGTTGGCG
JMFF045D09+ AATACCCCACTCCGATCCCGGCGACCACTCTTCCGGCCAGTAGATAGCCGTATGTTGGCG
                      ____________________________________________________________
consensus AATACCCCACTCCGATCCCGGCGACCACTCTTCCGGCCAGTAGATAGCCGTATGTTGGCG
 
. : . : . : . : . : . :
JMFF043I15+ CAAGCCCCATCAGGAGTGCACCTATTATGAAAGTCGCCGCCGCCAAAACTATGGTGTATC
JMFF045D09+ CAAGCCCCATCAGGAGTGCACCTATTATGAAAGTCGCCGCCGCCAAAACTATGGTGTATC
                      ____________________________________________________________
consensus CAAGCCCCATCAGGAGTGCACCTATTATGAAAGTCGCCGCCGCCAAAACTATGGTGTATC
 
. : . : . : . : . : . :
JMFF043I15+ GCCGGCCAATCATATCTGAAGTTTTCCCGGACGCCAGTGACCCAAACAACGACGACACGT
JMFF045D09+ GCCGGCCAATCATATCTGAAGTTTTCCCGGACGCCAGTGACCCAAACAACGACGACACGT
                      ____________________________________________________________
consensus GCCGGCCAATCATATCTGAAGTTTTCCCGGACGCCAGTGACCCAAACAACGACGACACGT
 
. : . : . : . : . : . :
JMFF043I15+ TCAACAAACTCACCAACAATTCATGCTGTACCGATGAAATCTTGAACGTTTCTTTAATGA
JMFF045D09+ TCAACAAACTCACCAACAATTCATGCTGTACCGATGAAATCTTGAACGTTTCTTTAATGA
                      ____________________________________________________________
consensus TCAACAAACTCACCAACAATTCATGCTGTACCGATGAAATCTTGAACGTTTCTTTAATGA
 
. : . : . : . : . : . :
JMFF043I15+ ACAGAACTGCACCACTCATCACCCCAAGATCATAACCCAAAAGAATAGAATTGGTGGAAG
JMFF045D09+ ACAGAACTGCACCACTCATCACCCCAAGATCATAACCCAAAAGAATAGAATTGGTGGAAG
                      ____________________________________________________________
consensus ACAGAACTGCACCACTCATCACCCCAAGATCATAACCCAAAAGAATAGAATTGGTGGAAG
 
. : . : . : . : . : . :
JMFF043I15+ CGAAAACGGCGCAAAGAAAAGCGAACTTGTTGAGACGACGCTTTGGGGGATGAGGGGAAC
JMFF045D09+ CGAAAACGGCGCAAAGAAAAGCGAACTTGTTGAGACGACGCTTTGGGGGATGAGGGGAAC
                      ____________________________________________________________
consensus CGAAAACGGCGCAAAGAAAAGCGAACTTGTTGAGACGACGCTTTGGGGGATGAGGGGAAC
 
. : . : . : . : . : . :
JMFF043I15+ CGTGGGCGCCGCCGGGTCGAGATTCAACCATTGTGATTTCCATGGGTTCTGTTCTCCCCT
JMFF045D09+ CGTGGGCGCCGCCGGGTCGAGATTCAACCATTGTGATTTCCATGGGTTCTGTTCTCCCCT
                      ____________________________________________________________
consensus CGTGGGCGCCGCCGGGTCGAGATTCAACCATTGTGATTTCCATGGGTTCTGTTCTCCCCT
 
. : . : . : . : . : . :
JMFF043I15+ TTGCAGAATCAATTCCAGAATCCATATTCTAGCTATCTAAATCCT
JMFF045D09+ TTGCAGAATCAATTCCAGAATCCATATTCTAGCTATCTAAATCCTGGTTTGGATCAACTA
JMSF024D22+ GCAGAATCAATTCCAGAATCCATATTCTAGCTATCTAAATCCTGGTTTGGATCAACTA
                      ____________________________________________________________
consensus TTGCAGAATCAATTCCAGAATCCATATTCTAGCTATCTAAATCCTGGTTTGGATCAACTA
 
. : . : . : . : . : . :
JMFF045D09+ ATCCTGTGGGCAAATAAGAAAGACGAGTATAGATGCATTAATTGATTAACTACCTACTAA
JMSF024D22+ ATCCTGTGGGCAAATAAGAAAGACGAGTATAGATGCATTAATTGATTAACTACCTACTAA
                      ____________________________________________________________
consensus ATCCTGTGGGCAAATAAGAAAGACGAGTATAGATGCATTAATTGATTAACTACCTACTAA
 
. : . : . : . : . : . :
JMFF045D09+ TACCAGTACTGTACTGACTAGTAGCA
JMSF024D22+ TACCAGTACTGTACTGACTAGTAGCAGTAATGGGCTAATGACCTGCAATATGAAGGACTG
                      ____________________________________________________________
consensus TACCAGTACTGTACTGACTAGTAGCAGTAATGGGCTAATGACCTGCAATATGAAGGACTG
 
. : . : . : . : . : . :
JMSF024D22+ AAAAAGGTAACATTATAACCAATTTTGTTGGGATATGTGATCATACATTTTTGTCCCTTA
                      ____________________________________________________________
consensus AAAAAGGTAACATTATAACCAATTTTGTTGGGATATGTGATCATACATTTTTGTCCCTTA
 
. : . : . : . : . : . :
JMSF024D22+ TAAGGTTGGGAATTCAAACCTCTCTCATATAGAAAAATCAATCTGGCCAACACTTTATCT
                      ____________________________________________________________
consensus TAAGGTTGGGAATTCAAACCTCTCTCATATAGAAAAATCAATCTGGCCAACACTTTATCT
 
. : . : . : . : . : . :
JMSF024D22+ TTTAATTGGACCGATCAGGTGTAAACCGGATTAGTCTAAGTATATGGTACAGATTTAAAG
                      ____________________________________________________________
consensus TTTAATTGGACCGATCAGGTGTAAACCGGATTAGTCTAAGTATATGGTACAGATTTAAAG
 
. : . : . : . : . : . :
JMSF024D22+ GTGTTTAGGGTATGCCGAATACACTCGATGATCTGATCTGACCAAAAAAAGGTAACAGTA
                      ____________________________________________________________
consensus GTGTTTAGGGTATGCCGAATACACTCGATGATCTGATCTGACCAAAAAAAGGTAACAGTA
 
. : . : . : . : . : . :
JMSF024D22+ TTATAGGATAAAGACACTAATAACTTCCTCCTTATTTCACTCGCACACATAACAAGTGAT
                      ____________________________________________________________
consensus TTATAGGATAAAGACACTAATAACTTCCTCCTTATTTCACTCGCACACATAACAAGTGAT
 
. : . : . : . : . : . :
JMSF024D22+ GTACCAAACTCCCATTTAAGGTTGTTTAATTTAGTACATAATTAAACATCAACCCCTTTC
                      ____________________________________________________________
consensus GTACCAAACTCCCATTTAAGGTTGTTTAATTTAGTACATAATTAAACATCAACCCCTTTC
 
. : . : . : . : . : . :
JMSF024D22+ ACAAGGAATTTGCATATAACACATCAAACAATCATGTATGTCTCTATAGTTGAGCTTTAA
                      ____________________________________________________________
consensus ACAAGGAATTTGCATATAACACATCAAACAATCATGTATGTCTCTATAGTTGAGCTTTAA
 
. : . : . : . : . : . :
JMSF024D22+ AAAATGAGAAAATGAAAGGTGAACTTCATTTCTTCACACAAATCTCCACTGATTATCTTC
                      ____________________________________________________________
consensus AAAATGAGAAAATGAAAGGTGAACTTCATTTCTTCACACAAATCTCCACTGATTATCTTC