Previous Contig 006203:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022A16Sequence570006203 (3)gb:AC104709_17377753e-49Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete s332009241 (3)gb:NTA244024_16912792e-32Nicotiana tabacum mRNA for phragmoplastin, dynamin-like protein.
JMSF024D21Sequence666006203 (3)gb:AC104709_17377752e-69Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete s705009241 (3)gb:NTA244024_1691279e-111Nicotiana tabacum mRNA for phragmoplastin, dynamin-like protein.
JMSF051C09Sequence693006203 (3)gb:AC104709_17377753e-74Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete s733009241 (3)gb:NTA244024_1691279e-113Nicotiana tabacum mRNA for phragmoplastin, dynamin-like protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051C09+ CTCAATGTAAGAGCGAACCATGTTTTCAATGTC
                      ____________________________________________________________
consensus CTCAATGTAAGAGCGAACCATGTTTTCAATGTC
 
. : . : . : . : . : . :
JMSF051C09+ ATAAACAATGCTTTCTGGCTGACCCTCAACAGCAACTTTAGTAAGTCCAGGAAGATCAAT
JMFF022A16+ CAACAGCAACTTTAGTAAGTCCAGGAAGATCAAT
JMSF024D21+ ACAATGCTTTCTGGCTGACCCTCAACAGCAACTTTAGTAAGTCCAGGAAGATCAAT
                      ____________________________________________________________
consensus ATAAACAATGCTTTCTGGCTGACCCTCAACAGCAACTTTAGTAAGTCCAGGAAGATCAAT
 
. : . : . : . : . : . :
JMSF051C09+ CAATGTCAAGTTCACAACATTAGGAGAATATATACTGAGATAAATAGGAACACTTGAGAT
JMFF022A16+ CAATGTCAAGTTCACAACATTAGGAGAATATATACTGAGATAAATAGGA--ACTTGAGAT
JMSF024D21+ CAATGTCAAGTTCACAACATTAGGAGAATATATACTGAGATAAATAGGAACACTTGAGAT
                      ____________________________________________________________
consensus CAATGTCAAGTTCACAACATTAGGAGAATATATACTGAGATAAATAGGAACACTTGAGAT
 
. : . : . : . : . : . :
JMSF051C09+ TGCTTTAGTACGGCCTGTCTCACGATCAGTTTCATCTGAAATTTCCTTCCTCACAGCAGC
JMFF022A16+ TGCTTTAGTACGGCCTGTCTCACGATCAGTTTCATCTGAAATTTCCTTCCTCACAGCAGC
JMSF024D21+ TGCTTTAGTACGGCCTGTCTCACGATCAGTTTCATCTGAAATTTCCTTCCTCACAGCAGC
                      ____________________________________________________________
consensus TGCTTTAGTACGGCCTGTCTCACGATCAGTTTCATCTGAAATTTCCTTCCTCACAGCAGC
 
. : . : . : . : . : . :
JMSF051C09+ AAAATCAGTAAACCTTTTCCTTGGAATGTGCCCAAATTCTGCATATTCTCGATTTTCATC
JMFF022A16+ AAAATCAGTAAACCTTTTCCTTGGAATGTGCCCAAATTCTGCATATTCTCGATTTTCATC
JMSF024D21+ AAAATCAGTAAACCTTTTCCTTGGAATGTGCCCAAATTCTGCATATTCTCGATTTTCATC
                      ____________________________________________________________
consensus AAAATCAGTAAACCTTTTCCTTGGAATGTGCCCAAATTCTGCATATTCTCGATTTTCATC
 
. : . : . : . : . : . :
JMSF051C09+ TATGCGATGAAGCTGTAGGACAAGTGGACGACGGGTCACAATACCTGATCCACGGGGTAA
JMFF022A16+ TATGCGATGAAGCTGTAGGACAAGTGGACGACGGGTCACAATACCTGATCCACGGGGTAA
JMSF024D21+ TATGCGATGAAGCTGTAGGACAAGTGGACGACGGGTCACAATACCTGATCCACGGGGTAA
                      ____________________________________________________________
consensus TATGCGATGAAGCTGTAGGACAAGTGGACGACGGGTCACAATACCTGATCCACGGGGTAA
 
. : . : . : . : . : . :
JMSF051C09+ AAAGTCCTTGCCAACAATGCTCTCTAGCACAGAAGACTTTCCTGAGCTCTGGCCACCGAC
JMFF022A16+ AAAGTCCTTGCCAACAATGCTCTCTAGCACAGAAGACTTTCCTGAGCTCTGGCCACCGAC
JMSF024D21+ AAAGTCCTTGCCAACAATGCTCTCTAGCACAGAAGACTTTCCTGAGCTCTGGCCACCGAC
                      ____________________________________________________________
consensus AAAGTCCTTGCCAACAATGCTCTCTAGCACAGAAGACTTTCCTGAGCTCTGGCCACCGAC
 
. : . : . : . : . : . :
JMSF051C09+ GACGGCGATGGAAGGTAACGCATCCCACAGAGTAGGCAAAGCACTGTCCTCACCGTGATC
JMFF022A16+ GACGGCGATGGAAGGTAACGCATCCCACAGAGTAGGCAAAGCACTGTCCTCACCGTGATC
JMSF024D21+ GACGGCGATGGAAGGTAACGCATCCCACAGAGTAGGCAAAGCACTGTCCTCACCGTGATC
                      ____________________________________________________________
consensus GACGGCGATGGAAGGTAACGCATCCCACAGAGTAGGCAAAGCACTGTCCTCACCGTGATC
 
. : . : . : . : . : . :
JMSF051C09+ GCCTAGCGCTGTGCAAGCTCTCTGCAATCTGTT
JMFF022A16+ GCCTAGCGCTGTGCAAGCTCTCTGCAATCTGTT
JMSF024D21+ GCCTAGCGCTGTGCAAGCTCTCTGCAATCTGTTTACCAATGAGATGAGGCTCTCCATTGT
                      ____________________________________________________________
consensus GCCTAGCGCTGTGCAAGCTCTCTGCAATCTGTTTACCAATGAGATGAGGCTCTCCATTGT
 
. : . : . : . : . : . :
JMSF024D21+ ATCTGTCCAAGTAACAGATCTGCGTCGATTTGAATCCGGAACCGCTAAAAACAAAAAACT
                      ____________________________________________________________
consensus ATCTGTCCAAGTAACAGATCTGCGTCGATTTGAATCCGGAACCGCTAAAAACAAAAAACT
 
. : . : . : . : . : . :
JMSF024D21+ ACTCGGCGAGTTGACAGATCAAATGGAGGGATTTTGAATTTCTGTACTGCAGACCGACAA
                      ____________________________________________________________
consensus ACTCGGCGAGTTGACAGATCAAATGGAGGGATTTTGAATTTCTGTACTGCAGACCGACAA
 
. : . : . : . : . : . :
JMSF024D21+ TCAAAATGAATCGGACGGAAATTTGAAGCAGTGGCAAAATTTTCTATAAGTTGGTTTCCC
                      ____________________________________________________________
consensus TCAAAATGAATCGGACGGAAATTTGAAGCAGTGGCAAAATTTTCTATAAGTTGGTTTCCC