Previous Contig 006202:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024D18Sequence603006202 (4)gb:AE005172_8897638e-06Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153899720013913 (3)sp|Q06548|APKA_ARATH2e-60Protein kinase APK1A (EC 2.7.1.-).>pir|S28615|S28615 serine/threonine/tyrosine-s
JMSF037K24Sequence171006202 (4)589013913 (3)sp|Q06548|APKA_ARATH8e-39Protein kinase APK1A (EC 2.7.1.-).>pir|S28615|S28615 serine/threonine/tyrosine-s
JMSF048D16Sequence655006202 (4)gb:AK118585_18165542e-27Arabidopsis thaliana At2g28930 mRNA for putative protein kinase, complete cds, c109024298
JMSF050P08Sequence269006202 (4)476013913 (3)sp|Q06548|APKA_ARATH6e-15Protein kinase APK1A (EC 2.7.1.-).>pir|S28615|S28615 serine/threonine/tyrosine-s

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048D16+ GGT
                      ____________________________________________________________
consensus GGT
 
. : . : . : . : . : . :
JMSF048D16+ CATCCCGGACCCGGGCTTTGACGCCACAAGAGTGTGNTCATCAACCCATCCTTTGAAAAC
                      ____________________________________________________________
consensus CATCCCGGACCCGGGCTTTGACGCCACAAGAGTGTGNTCATCAACCCATCCTTTGAAAAC
 
. : . : . : . : . : . :
JMSF048D16+ AGAACCAAAACCCCCTTCCCCCAACACACTGTCGGGACGGAAGTTTCTGGTGGCCGCTTT
JMSF024D18+ CCAAAACCCCCTTCCCCCAACACACNGTNGGGACGGAAG-TTNTGGTGGCCGNTTT
                      ____________________________________________________________
consensus AGAACCAAAACCCCCTTCCCCCAACACACTGTCGGGACGGAAGTTTCTGGTGGCCGCTTT
 
. : . : . : . : . : . :
JMSF048D16+ CAGTTCACTGAAAGTGAAACTCTTCAAGTTGGAGGACTGCAAGATTTCACCCTCACTACG
JMSF024D18+ CAGTTCANTGAAAGTGAAACTNTTCAAGTTGGAGGANTGCAAGATTTCACCCTCANTACG
                      ____________________________________________________________
consensus CAGTTCACTGAAAGTGAAACTCTTCAAGTTGGAGGACTGCAAGATTTCACCCTCACTACG
 
. : . : . : . : . : . :
JMSF048D16+ AGGCGTGGGTGGTACAGAAGCCGATGATAGCTTGTTCGAGTTACTCGATTCAGTCCCATT
JMSF024D18+ AGGCGTGGGTGGTACAGAAGCCGATGATAGNTTGTTNGAGTTACTNGATTCAGTCCCATT
                      ____________________________________________________________
consensus AGGCGTGGGTGGTACAGAAGCCGATGATAGCTTGTTCGAGTTACTCGATTCAGTCCCATT
 
. : . : . : . : . : . :
JMSF048D16+ CCCACTCACATTTCTAGAATCCACCCCTGAACCAACATAAAATGCAGTCTCAGCTTTGAT
JMSF024D18+ CCCACTCACATTTNTAGAATCCACCCCTGAACCAACATAAAATGCAGTNTCAGCTTTGAT
                      ____________________________________________________________
consensus CCCACTCACATTTCTAGAATCCACCCCTGAACCAACATAAAATGCAGTCTCAGCTTTGAT
 
. : . : . : . : . : . :
JMSF048D16+ TTGGTTGCTCAAACAAATCCCCATCACAATAAATACCTCAAGAAAAAACAAAAGATAGTA
JMSF024D18+ TTGGTTGCTCAAACAAATCCCCATCACAATAAATACCTCAAGAAAAAACAAAAGATAGTA
                      ____________________________________________________________
consensus TTGGTTGCTCAAACAAATCCCCATCACAATAAATACCTCAAGAAAAAACAAAAGATAGTA
 
. : . : . : . : . : . :
JMSF048D16+ ACAAAATCAAGAAATAGTCATGTATAAAGCTCAGTAAAAACCCCACAGGGCCCCTGAGCC
JMSF050P08+ CAGTAAAAACCCCNCAGGGCCCGTGAGCC
JMSF024D18+ ACAAAATCAAGAAATAGTCATGTATAAAGCTCAGTAAAAACCCCACAGGGCCCCTGAGCC
                      ____________________________________________________________
consensus ACAAAATCAAGAAATAGTCATGTATAAAGCTCAGTAAAAACCCCACAGGGCCCCTGAGCC
 
. : . : . : . : . : . :
JMSF048D16+ TAGATCTAGTGTGAATCTATAGATTTATCCCTTTCAGCTCTCTCCAAAGGTTGGTTGTTA
JMSF050P08+ TAGATCTAGTGTGANTNTATAGATTTATCCCNNTCAGCTCTCTCCAANGGTGGGTGGTTA
JMSF024D18+ TAGATCTAGTGTGAATCTATAGATTTATCCCTTTCAGCTCTCTCCAAAGGTTGGTTGTTA
                      ____________________________________________________________
consensus TAGATCTAGTGTGAATCTATAGATTTATCCCTTTCAGCTCTCTCCAAAGGTTGGTTGTTA
 
. : . : . : . : . : . :
JMSF048D16+ GTCTCCAACTACCCCCCCTATATCTCTCTCTCCATATATAAATATACACTAATATACCCC
JMSF050P08+ GTCTCCAACTACCCCCCCTATATCTCTCTCTCCATATATAAATATACACTAATATACCCC
JMSF037K24+ TACCCCCCCTATATCTCTCTCTCCATATATAAATATACACTAATATACCCC
JMSF024D18+ GTCTCCAACTACCCCCCCTATATCTCTCTCTCCATATATAAATATACACTAATATACCCC
                      ____________________________________________________________
consensus GTCTCCAACTACCCCCCCTATATCTCTCTCTCCATATATAAATATACACTAATATACCCC
 
. : . : . : . : . : . :
JMSF048D16+ AACTTGTCTTGTAGGTAAGATAACCGGTGAGGAAATTGAAAAAACAAGAAAACCCAAACT
JMSF050P08+ AACTTGTCTTGTAGGTAAGATAACCGGTGAGGAAATTGAAAAAACAAGAAAACCCAAACT
JMSF037K24+ AACTTGTCTTGTAGGTAAGATAACCGGTGAGGAAATTGAAAAAACAAGAAAACCCAAACT
JMSF024D18+ AACTTGTCTTGTAGGTAAGATAACCGGTGAGGAAATTGAAAAAACAAGAAAACCCAAACT
                      ____________________________________________________________
consensus AACTTGTCTTGTAGGTAAGATAACCGGTGAGGAAATTGAAAAAACAAGAAAACCCAAACT
 
. : . : . : . : . : . :
JMSF048D16+ TTTGAACAAAAAATTGTATCTTTCCAGTGGATTTCGGATGAGAAAACCCTT
JMSF050P08+ TTTGAACAAAAAATTGTATCTTTCCAGTGGATTTCGGATGAGAAAACCCTTGAGACAACC
JMSF037K24+ TTTGAACAAAAAATTGTATCTTTCCAGTGGATTTCGGATGAGAAAACCCTTGAGACAACC
JMSF024D18+ TTTGAACAAAAAATTGTATCTTTCCAGTGGATTTCGGATGAGAAAACCCTTGAGACAACC
                      ____________________________________________________________
consensus TTTGAACAAAAAATTGTATCTTTCCAGTGGATTTCGGATGAGAAAACCCTTGAGACAACC