Previous Contig 006201:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044E20Sequence619006201 (3)gb:AB017069_15134735e-50Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ8.>gb:AY052284_15626643010614 (3)
JMFF046C01Sequence597006201 (3)gb:AB017069_15134731e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ8.>gb:AY052284_15626594010614 (3)
JMSF024D17Sequence724006201 (3)gb:AB017069_15134732e-49Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ8.>gb:AY052284_15626779010614 (3)gb:AP005841_18589052e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024D17+ GCTT
                      ____________________________________________________________
consensus GCTT
 
. : . : . : . : . : . :
JMSF024D17+ TTGGATGAAGTAGGGTTGTGCTAGTGGCATTACCTTTGGGGGGCTTCTTTCNTGAAGCAG
                      ____________________________________________________________
consensus TTGGATGAAGTAGGGTTGTGCTAGTGGCATTACCTTTGGGGGGCTTCTTTCNTGAAGCAG
 
. : . : . : . : . : . :
JMFF044E20+ TTGCAAAATTGTAAAAGCCATTCTGCATCGGTTGTGATGGATCTCCATTAGAGG
JMFF046C01+ TTGCAAAATNGTAAAAGCCATTCTGCATCGGTTGTGATGGATCTCCATNAGAGG
JMSF024D17+ TACTCTTTGCAAAATTGTAAAAGCCATTCTGCATCGGTTGTGATGGATCTCCATTAGAGG
                      ____________________________________________________________
consensus TACTCTTTGCAAAATTGTAAAAGCCATTCTGCATCGGTTGTGATGGATCTCCATTAGAGG
 
. : . : . : . : . : . :
JMFF044E20+ ACTGAACATTCTTCTGGAACACATTAGCATGCTTCTGGTCATATGCTGATTTTTTGTCCT
JMFF046C01+ ACTGAACATTCTTCTGGAACACATTAGCATGCTTCTGGTCATATGCTGATTTTTTGTCCT
JMSF024D17+ ACTGAACATTCTTCTGGAACACATTAGCATGCTTCTGGTCATATGCTGATTTTTTGTCCT
                      ____________________________________________________________
consensus ACTGAACATTCTTCTGGAACACATTAGCATGCTTCTGGTCATATGCTGATTTTTTGTCCT
 
. : . : . : . : . : . :
JMFF044E20+ TGTCAGAAAGCAAGCTCCAGGCTTCTGAAAGATGTTTAAAGGCTCCTTCAGCACCAATAG
JMFF046C01+ TGTCAGAAAGCAAGCTCCAGGCTTCTGAAAGATGTTTAAAGGCTCCTTCAGCACCAATAG
JMSF024D17+ TGTCAGAAAGCAAGCTCCAGGCTTCTGAAAGATGTTTAAAGGCTCCTTCAGCACCAATAG
                      ____________________________________________________________
consensus TGTCAGAAAGCAAGCTCCAGGCTTCTGAAAGATGTTTAAAGGCTCCTTCAGCACCAATAG
 
. : . : . : . : . : . :
JMFF044E20+ ATTTGTTCTTATCAGGATGAAGAATAAGAGCCAATTTCCTGTACTGCTTTCTAATTGCAT
JMFF046C01+ ATTTGTTCTTATCAGGATGAAGAATAAGAGCCAATTTCCTGTACTGCTTTCTAATTGCAT
JMSF024D17+ ATTTGTTCTTATCAGGATGAAGAATAAGAGCCAATTTCCTGTACTGCTTTCTAATTGCAT
                      ____________________________________________________________
consensus ATTTGTTCTTATCAGGATGAAGAATAAGAGCCAATTTCCTGTACTGCTTTCTAATTGCAT
 
. : . : . : . : . : . :
JMFF044E20+ CTTCATCAGCTTGTGGATTAACACCAAGAATTTCATAAAAGTTCACTTCCCCATTAACTC
JMFF046C01+ CTTCATCAGCTTGTGGATTAACACCAAGAATTTCATAAAAGTTCACTTCCCCATTAACTC
JMSF024D17+ CTTCATCAGCTTGTGGATTAACACCAAGAATTTCATAAAAGTTCACTTCCCCATTAACTC
                      ____________________________________________________________
consensus CTTCATCAGCTTGTGGATTAACACCAAGAATTTCATAAAAGTTCACTTCCCCATTAACTC
 
. : . : . : . : . : . :
JMFF044E20+ TGTTCTCAGCAGAAACATAAATATCAAGTGTTGCCAACATCTGTGCAATGCCTTCAAGTC
JMFF046C01+ TGTTCTCAGCAGAAACATAAATATCAAGTGTTGCCAACATCTGTGCAATGCCTTCAAGTC
JMSF024D17+ TGTTCTCAGCAGAAACATAAATATCAAGTGTTGCCAACATCTGTGCAATGCCTTCAAGTC
                      ____________________________________________________________
consensus TGTTCTCAGCAGAAACATAAATATCAAGTGTTGCCAACATCTGTGCAATGCCTTCAAGTC
 
. : . : . : . : . : . :
JMFF044E20+ CAGGATATAAAGTCTGTGCCTTGTGAGCAAATTTCTTTGCTCCAATAACATCCTTTGCTA
JMFF046C01+ CAGGATATAAAGTCTGTGCCTTGTGAGCAAATTTCTTTGCTCCAATAACATCCTTTGCTA
JMSF024D17+ CAGGATATAAAGTCTGTGCCTTGTGAGCAAATTTCTTTGCTCCAATAACATCCTTTGCTA
                      ____________________________________________________________
consensus CAGGATATAAAGTCTGTGCCTTGTGAGCAAATTTCTTTGCTCCAATAACATCCTTTGCTA
 
. : . : . : . : . : . :
JMFF044E20+ AAAACTTCTTCTCTGCAATTTCTTTCGACCTCATAGCCTCATCTTTGTTACAATCCATCA
JMFF046C01+ AAAACTTCTTCTCTGCAATTTCTTTCGACCTCATAGCCTCATCTTTGTTACAATCCATCA
JMSF024D17+ AAAACTTCTTCTCTGCAATTTCTTTCGACCTCATAGCCTCATCTTTGTTACAATCCATCA
                      ____________________________________________________________
consensus AAAACTTCTTCTCTGCAATTTCTTTCGACCTCATAGCCTCATCTTTGTTACAATCCATCA
 
. : . : . : . : . : . :
JMFF044E20+ ACCTTGCCTATCTTGTTGTCACCGAATTGATATAGTACAATAGAAACAGAGGCACAGAGC
JMFF046C01+ ACCTTGCCTATCTTGTTGTCACCGAATTGATATAGTACAATAGAAACAGAGGCACAGAGC
JMSF024D17+ ACCTTGCCTATCTTGTTGTCACCGAATTGATATAGTACAATAGAAACAGAGGCACAGAGC
                      ____________________________________________________________
consensus ACCTTGCCTATCTTGTTGTCACCGAATTGATATAGTACAATAGAAACAGAGGCACAGAGC
 
. : . : . : . : . : . :
JMFF044E20+ TGGTCGGGGCTTAAAGCTTTGAATCACAGACAAGCCATGGACGAGAAGCTCAATCGCAAA
JMFF046C01+ TGGTCGGGGCTTAAAGCTTTGAATCACAGACAAGCCATGGACGAGAAGCTCAATAGCAAA
JMSF024D17+ TGGTCGGGGCTTAAAGCTTTGAATCACAGACAAGCCATGGACGAGAAGCTCAATCGCAAA
                      ____________________________________________________________
consensus TGGTCGGGGCTTAAAGCTTTGAATCACAGACAAGCCATGGACGAGAAGCTCAATCGCAAA
 
. : . : . : . : . : . :
JMFF044E20+ CTGATTTTCTTTTCCTTTCTTCTTT
JMFF046C01+ CT
JMSF024D17+ CTGATTTTCTTTTCCTTTCTTCTTTGGGTTTTTGCCCCTGATTTCCTAAGTTTAATTCCC
                      ____________________________________________________________
consensus CTGATTTTCTTTTCCTTTCTTCTTTGGGTTTTTGCCCCTGATTTCCTAAGTTTAATTCCC