Previous Contig 006198:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031K08Sequence554006198 (2)gb:AY087538_15725682e-14Arabidopsis thaliana clone 36448 mRNA, complete sequence.675012347 (2)gb:AY087538_15725681e-09Arabidopsis thaliana clone 36448 mRNA, complete sequence.
JMSF024C20Sequence679006198 (2)gb:AY087538_15725684e-15Arabidopsis thaliana clone 36448 mRNA, complete sequence.758012347 (2)gb:AY087538_15725683e-07Arabidopsis thaliana clone 36448 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024C20+ GCGGAAATCGGGGACTCCG
                      ____________________________________________________________
consensus GCGGAAATCGGGGACTCCG
 
. : . : . : . : . : . :
JMSF024C20+ CCGNCCCCATGAACCGCCGGAAACGGCGGTAAGGGGGAGGGAGGCTGAGCTTGAACGTGG
                      ____________________________________________________________
consensus CCGNCCCCATGAACCGCCGGAAACGGCGGTAAGGGGGAGGGAGGCTGAGCTTGAACGTGG
 
. : . : . : . : . : . :
JMSF024C20+ CGCTGATCGCCGATAAACCCTCCACCACCCAGCATCTGATTGGTGGGGAGCGGCTGAAGA
                      ____________________________________________________________
consensus CGCTGATCGCCGATAAACCCTCCACCACCCAGCATCTGATTGGTGGGGAGCGGCTGAAGA
 
. : . : . : . : . : . :
JMFF031K08+ AGCGGC
JMSF024C20+ GGAGGGCCGCCGACAACGTTCATCAGCTGCGGCGGCCGGTTACCGATTTGCGCGAGCGGC
                      ____________________________________________________________
consensus GGAGGGCCGCCGACAACGTTCATCAGCTGCGGCGGCCGGTTACCGATTTGCGCGAGCGGC
 
. : . : . : . : . : . :
JMFF031K08+ GGCGGGCGAATCCTCTGCAGCCTCGAACTGGGCGGCTTGGGCTGGTGAATGGGCGGCGGA
JMSF024C20+ GGCGGGCGAATCCTCTGCAGCCTCGAACTGGGCGGCTTGGGCTGGTGAATGGGCGGCGGA
                      ____________________________________________________________
consensus GGCGGGCGAATCCTCTGCAGCCTCGAACTGGGCGGCTTGGGCTGGTGAATGGGCGGCGGA
 
. : . : . : . : . : . :
JMFF031K08+ GTAGCCATCCGCTCATGCGCCGGAGATCCGGTGAGCTTCTGAACCACATCGCGAAAATCA
JMSF024C20+ GTAGCCATCCGCTCATGCGCCGGAGATCCGGTGAGCTTCTGAACCACATCGCGAAAATCA
                      ____________________________________________________________
consensus GTAGCCATCCGCTCATGCGCCGGAGATCCGGTGAGCTTCTGAACCACATCGCGAAAATCA
 
. : . : . : . : . : . :
JMFF031K08+ CTCTTGTTTATATTATAAACCGGAGGCTGCTGCTGCGGCGCCGCCGCCGCCGCAGCAGGC
JMSF024C20+ CTCTTGTTTATATTATAAACCGGAGGCTGCTGCTGCGGCGCCGCCGCCGCCGCAGCAGGC
                      ____________________________________________________________
consensus CTCTTGTTTATATTATAAACCGGAGGCTGCTGCTGCGGCGCCGCCGCCGCCGCAGCAGGC
 
. : . : . : . : . : . :
JMFF031K08+ GGCTGAGCCTGGACATCATTAACTATCTGAGAACTGAGAAGACTCTGATTCTCATACACC
JMSF024C20+ GGCTGAGCCTGGACATCATTAACTATCTGAGAACTGAGAAGACTCTGATTCTCATACACC
                      ____________________________________________________________
consensus GGCTGAGCCTGGACATCATTAACTATCTGAGAACTGAGAAGACTCTGATTCTCATACACC
 
. : . : . : . : . : . :
JMFF031K08+ GGTGGCCTCCGAACAGGCTTAGAAATCTTATGAGAAATCTTGCTAAGATTCTTCAAGATA
JMSF024C20+ GGTGGCCTCCGAACAGGCTTAGAAATCTTATGAGAAATCTTGCTAAGATTCTTCAAGATA
                      ____________________________________________________________
consensus GGTGGCCTCCGAACAGGCTTAGAAATCTTATGAGAAATCTTGCTAAGATTCTTCAAGATA
 
. : . : . : . : . : . :
JMFF031K08+ GTATCGCTTCCGCCATTATTATTACCGCTTGAAGCAGATAGAGTAGTGGAGGAAGAATCA
JMSF024C20+ GTATCGCTTCCGCCATTATTATTACCGCTTGAAGCAGATAGAGTAGTGGAGGAAGAATCA
                      ____________________________________________________________
consensus GTATCGCTTCCGCCATTATTATTACCGCTTGAAGCAGATAGAGTAGTGGAGGAAGAATCA
 
. : . : . : . : . : . :
JMFF031K08+ GCACCGCTCCCTGAAGAATGAGAACCTCTATCCATCAACCGCCACACAAATAACACACCT
JMSF024C20+ GCACCGCTCCCTGAAGAATGAGAACCTCTATCCATCAACCGCCACACAAATAACACACCT
                      ____________________________________________________________
consensus GCACCGCTCCCTGAAGAATGAGAACCTCTATCCATCAACCGCCACACAAATAACACACCT
 
. : . : . : . : . : . :
JMFF031K08+ CTTCTCCTTCTTCTTCTTTCTCTTTCTAGATATCTTTACCTCTCTCTCTCTAT
JMSF024C20+ CTTCTCCTTCTTCTTCTTTCTCTTTCTAGATATCTTTACCTCTCTCTCTCTATAATTGTC
                      ____________________________________________________________
consensus CTTCTCCTTCTTCTTCTTTCTCTTTCTAGATATCTTTACCTCTCTCTCTCTATAATTGTC