Previous Contig 006197:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024C11Sequence377006197 (2)726013452 (2)gb:AY735656_16256981e-56Arabidopsis thaliana hypothetical protein AT4G29400 mRNA, complete cds.
JMSF042P14Sequence437006197 (2)674013452 (2)gb:AY735656_16256982e-51Arabidopsis thaliana hypothetical protein AT4G29400 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042P14+ TNTNNNTCANNATCNNT
                      ____________________________________________________________
consensus TNTNNNTCANNATCNNT
 
. : . : . : . : . : . :
JMSF042P14+ NTCATCTCCTNTCCCTNNTAAGCCACCAAAACCCTCATCATCCTCTTCCTCCTCCTCTTC
JMSF024C11+ CTCTTCCTCCTCCTCTTC
                      ____________________________________________________________
consensus NTCATCTCCTNTCCCTNNTAAGCCACCAAAACCCTCATCATCCTCTTCCTCCTCCTCTTC
 
. : . : . : . : . : . :
JMSF042P14+ TATCCCTCCAAACCCTCTGAATCCACCAAAGCCTTCCACCTCCTCCTCATCTTTGTCGCC
JMSF024C11+ TATCCCTCCAAACCCTCTGAATCCACCAAAGCCTTCCACCTCCTCCTCATCTTTGTCGCC
                      ____________________________________________________________
consensus TATCCCTCCAAACCCTCTGAATCCACCAAAGCCTTCCACCTCCTCCTCATCTTTGTCGCC
 
. : . : . : . : . : . :
JMSF042P14+ ATAGATGTTGCTTTCTTCCAATCGGGTTAGGGAATTCTTGGTTTCTGATCTCCGGGTGTT
JMSF024C11+ ATAGATGTTGCTTTCTTCCAATCGGGTTAGGGAATTCTTGGTTTCTGATCTCCGGGTGTT
                      ____________________________________________________________
consensus ATAGATGTTGCTTTCTTCCAATCGGGTTAGGGAATTCTTGGTTTCTGATCTCCGGGTGTT
 
. : . : . : . : . : . :
JMSF042P14+ GCTTGCGCTGGTAATATGAGAACATGGGTTTAGTTGCAAATGAGTTCGAGTTGGAAATGA
JMSF024C11+ GCTTGCGCTGGTAATATGAGAACATGGGTTTAGTTGCAAATGAGTTCGAGTTGGAAATGA
                      ____________________________________________________________
consensus GCTTGCGCTGGTAATATGAGAACATGGGTTTAGTTGCAAATGAGTTCGAGTTGGAAATGA
 
. : . : . : . : . : . :
JMSF042P14+ AAAGCGTAGAAATGGTTGGGCGCCATAGGGTTGAGAAAAATATGAAGTAGTGGGTGGTAG
JMSF024C11+ AAAGCGTAGAAATGGTTGGGCGCCATAGGGTTGAGAAAAATATGAAGTAGTGGGTGGTAG
                      ____________________________________________________________
consensus AAAGCGTAGAAATGGTTGGGCGCCATAGGGTTGAGAAAAATATGAAGTAGTGGGTGGTAG
 
. : . : . : . : . : . :
JMSF042P14+ TTGAAAATGAGAAGTGGAGGATTGAAGAAGATGAAGGGTAAACATAGGTGGCGGTCGGTA
JMSF024C11+ TTGAAAATGAGAAGTGGAGGATTGAAGAAGATGAAGGGTAAACATAGGTGGCGGTCGGTA
                      ____________________________________________________________
consensus TTGAAAATGAGAAGTGGAGGATTGAAGAAGATGAAGGGTAAACATAGGTGGCGGTCGGTA
 
. : . : . : . : . : . :
JMSF042P14+ GTTGATAAGCAGGCGTGGGTTGGCTGCCGTTCAGCGGGGAAGAAGAGAAGACTCACGTCC
JMSF024C11+ GTTGATAAGCAGGCGTGGGTTGGCTGCCGTTCAG-GGGGAAGAAGAGAAGACTCACGTCC
                      ____________________________________________________________
consensus GTTGATAAGCAGGCGTGGGTTGGCTGCCGTTCAGCGGGGAAGAAGAGAAGACTCACGTCC