Previous Contig 006195:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016D06Sequence508006195 (5)784012341 (5)gb:ATAC010927_15432202e-43Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequen
JMSF024B20Sequence660006195 (5)gb:ATAC010927_15432203e-09Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequen763012341 (5)gb:ATAC010927_15432208e-36Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequen
JMSF027N15Sequence647006195 (5)gb:ATAC010927_15432205e-09Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequen730012341 (5)gb:ATAC010927_15432208e-38Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequen
JMSF033G20Sequence659006195 (5)gb:ATAC010927_15432203e-09Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequen736012341 (5)gb:ATAC010927_15432204e-38Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequen
JMSF034G20Sequence515006195 (5)694012341 (5)gb:ATAC010927_15432201e-33Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024B20+ C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
JMSF033G20+ ACTCTGCTGTCTAATTGATGATGTCGTAATAGATCTCACTGGCTGAGGAGGAACCCCAGC
JMSF027N15+ TCTAATTGATGATGTCGTAATAGATCTCACTGGCTGAGGAGGAACCCCAGC
JMSF024B20+ ACTCTGCTGTCTAATTGATGATGTCGTAATAGATCTCACTGGCTGAGGAGGAACCCCAGC
                      ____________________________________________________________
consensus ACTCTGCTGTCTAATTGATGATGTCGTAATAGATCTCACTGGCTGAGGAGGAACCCCAGC
 
. : . : . : . : . : . :
JMSF033G20+ TGGTCGCATTGGCATACTCGAACCAAGCGACCCTGTAATTCCAATCCCTTGCATTCCTTG
JMSF027N15+ TGGTCGCATTGGCATACTCGAACCAAGCGACCCTGTAATTCCAATCCCTTGCATTCCTTG
JMSF024B20+ TGGTCGCATTGGCATACTCGAACCAAGCGACCCTGTAATTCCAATCCCTTGCATTCCTTG
                      ____________________________________________________________
consensus TGGTCGCATTGGCATACTCGAACCAAGCGACCCTGTAATTCCAATCCCTTGCATTCCTTG
 
. : . : . : . : . : . :
JMSF033G20+ TACAGGTCTCCCCTGGGCTGAACTCGAACTAGGCAGAGAATCAGGCACACCGCGACCCAA
JMSF027N15+ TACAGGTCTCCCCTGGGCTGAACTCGAACTAGGCAGAGAATCAGGCACACCGCGACCCAA
JMSF016D06+ GGCAGAGANTCAGGCACACCGCGACCCAA
JMSF034G20+ GAACTAGGCAGAGAATCAGGCACACCGCGACCCAA
JMSF024B20+ TACAGGTCTCCCCTGGGCTGAACTCGAACTAGGCAGAGAATCAGGCACACCGCGACCCAA
                      ____________________________________________________________
consensus TACAGGTCTCCCCTGGGCTGAACTCGAACTAGGCAGAGAATCAGGCACACCGCGACCCAA
 
. : . : . : . : . : . :
JMSF033G20+ CCCACCAAATTGCTGCCCAAAAGAAGGCGGAGCCAATGATGAAAAGGAGGCAGGCGGCGG
JMSF027N15+ CCCACCAAATTGCTGCCCAAAAGAAGGCGGAGCCAATGATGAAAAGGAGGCAGGCGGCGG
JMSF016D06+ CCCACCAAATTGCTGCCCAAAAGAAGGCGGAGCCAATGATGAAAAGGAGGCAGGCGGCGG
JMSF034G20+ CCCACCAAATTNCTGCCCAAAAGAAGNCGNNNCCAATGATGAAAAGGACGCAGGCGGCGG
JMSF024B20+ CCCACCAAATTGCTGCCCAAAAGAAGGCGGAGCCAATGATGAAAAGGAGGCAGGCGGCGG
                      ____________________________________________________________
consensus CCCACCAAATTGCTGCCCAAAAGAAGGCGGAGCCAATGATGAAAAGGAGGCAGGCGGCGG
 
. : . : . : . : . : . :
JMSF033G20+ AGAAGGGCCAGGCTGGTGGGCAGGGACCCCAATTGCCAACCCACCTCTAGCAGGCGGCGG
JMSF027N15+ AGAAGGGCCAGGCTGGTGGGCAGGGACCCCAATTGCCAACCCACCTCTAGCAGGCGGCGG
JMSF016D06+ AGAAGGGCCAGGCTGGTGGGCAGGGACCCCAATTGCCAACCCACCTCTAGCAGGCGGCGG
JMSF034G20+ AGAAGNTCCAGGCTGGTGGGCAGGGACCCCAATTGCCAACCCACCTCTAGCAGNCGGCGG
JMSF024B20+ AGAAGGGCCAGGCTGGTGGGCAGGGACCCCAATTGCCAACCCACCTCTAGCAGGCGGCGG
                      ____________________________________________________________
consensus AGAAGGGCCAGGCTGGTGGGCAGGGACCCCAATTGCCAACCCACCTCTAGCAGGCGGCGG
 
. : . : . : . : . : . :
JMSF033G20+ CACGGTTAGCGAAGAAGGAGGATGAGTCAAGTGCTGGAAAGGCGAGGGTTGTTGGCGGGA
JMSF027N15+ CACGGTTAGCGAAGAAGGAGGATGAGTCAAGTGCTGGAAAGGCGAGGG---TTGGCGGGA
JMSF016D06+ CACGGTTAGCGAAGAAGGAGGATGAGTCAAGTGCTGGAAAGGCGAGGGTTGTTGGCGGGA
JMSF034G20+ CACNGTTAGCGAAGAAGGAGGATGAGTCAAGTGCTGNAAAGNCNAGGGTTNTTGGCGGGA
JMSF024B20+ CACGGTTAGCGAAGAAGGAGGATGAGTCAAGTGCTGGAAAGGCGAGGGTTGTTGGCGGGA
                      ____________________________________________________________
consensus CACGGTTAGCGAAGAAGGAGGATGAGTCAAGTGCTGGAAAGGCGAGGGTTGTTGGCGGGA
 
. : . : . : . : . : . :
JMSF033G20+ GCTAGCGAAAGAGGACGGGGGCTCTGAA-GCTGGCCTTGATTGAGGGTTTTGCGAGGCTG
JMSF027N15+ GCTAGCGAAAGAGGACGGGGGCTCTGAA-GCTGGCCTTGATTGAGGGTTTTGCGAGGCTG
JMSF016D06+ GCTAGCGAAAGAGGACGGGGGCTCTGAA-GCTGGCCTTGATTGAGGGTTTTGCGAGGCTG
JMSF034G20+ GCTAGCGAAAGAGGACGGGGGCTCTGAATGCTGCCCTNNATTGAGGGTTTTCCGAGGCTG
JMSF024B20+ GCTAGCGAAAGAGGACGGGGGCTCTGAA-GCTGGCCTTGATTGAGGGTTTTGCGAGGCTG
                      ____________________________________________________________
consensus GCTAGCGAAAGAGGACGGGGGCTCTGAA-GCTGGCCTTGATTGAGGGTTTTGCGAGGCTG
 
. : . : . : . : . : . :
JMSF033G20+ GGGTCACGGATGTAGAAGCAGAGGGGTTTAGGGTTGGTTTCGTAGAAGATGCTGGCGTCG
JMSF027N15+ GGGTCACGGATGTAGAAGCAGAGGGGTTTAGGGTTGGTTTCGTAGAAGATGCTGGCGTCG
JMSF016D06+ GGGTCACGGATGTAGAAGCAGAGGGGTTTAGGGTTGGTTTCGTAGAAGATGCTGGCGTCG
JMSF034G20+ GGGTCANGGATGTAGAAGCAGAGGGGTTTAGGGTTGGTTTCGTAGAAGATNCTGGCTTCG
JMSF024B20+ GGGTCACGGATGTAGAAGCAGAGGGGTTTAGGGTTGGTTTCGTAGAAGATGCTGGCGTCG
                      ____________________________________________________________
consensus GGGTCACGGATGTAGAAGCAGAGGGGTTTAGGGTTGGTTTCGTAGAAGATGCTGGCGTCG
 
. : . : . : . : . : . :
JMSF033G20+ AAGGAGGAGGGAGTGAGGAAGTAAGGGATGGTGCTGAGGAGGTAGATGCGGCAGAAGGTG
JMSF027N15+ AAGGAGGAGGGAGTGAGGAAGTAAGGGATGGTGCTGAGGAGGTAGATGCGGCAGAAGGTG
JMSF016D06+ AAGGAGGAGGGAGTGAGGAAGTAAGGGATGGTGCTGAGGAGGTAGATGCGGCAGAAGGTG
JMSF034G20+ AAGGAGGAGGGAGTGAGGAANTAAGGGATGGTGCTGAGGAGNTAGATGCGGCAGAAGGTG
JMSF024B20+ AAGGAGGAGGGAGTGAGGAAGTAAGGGATGGTGCTGAGGAGGTAGATGCGGCAGAAGGTG
                      ____________________________________________________________
consensus AAGGAGGAGGGAGTGAGGAAGTAAGGGATGGTGCTGAGGAGGTAGATGCGGCAGAAGGTG
 
. : . : . : . : . : . :
JMSF033G20+ AAGGAGTAGGTGTTAGTGATGGAGGTGGCGGTTGTTGTTGCGGCGGTGACGACCGTTCGC
JMSF027N15+ AAGGAGTAGGTGTTAGTGATGGAGGTGGCGGTTGTTGTTGCGGCGGTGACGACCGTTCGC
JMSF016D06+ AAGGAGTAGGTGTTAGTGATGGAGGTGGCGGTTGTTGTTGCGGCGGTGACGACCGTTCGC
JMSF034G20+ AAGGAGTAGGTGTTAGTGATGGAGGTGGCGGTTGTTGTTGCGGCGGTGACGACCGTTCGC
JMSF024B20+ AAGGAGTAGGTGTTAGTGATGGAGGTGGCGGTTGTTGTTGCGGCGGTGACGACCGTTCGC
                      ____________________________________________________________
consensus AAGGAGTAGGTGTTAGTGATGGAGGTGGCGGTTGTTGTTGCGGCGGTGACGACCGTTCGC
 
. : . : . : . : . : . :
JMSF033G20+ TTGGCGGCGGCGGTTGTTGCTCCATTGAAGTAAATTGGACTGCAAATCAGTAATACGGTC
JMSF027N15+ TTGGCGGCGGCGGTTGTTGCTCCATTGAAGTAAATTGGACTGCAAATCAGTAATACGGTC
JMSF016D06+ TTGGCGGCGGCGGTTGTTGCTCCATTGAAGTAAATTGGACTGCAAATCAGTAATACG
JMSF034G20+ TNGGCGNCGGCGNTTGTTGCTCCATTGAAGTAANTTGGACTGCAAATCANTAATNCGGTC
JMSF024B20+ TTGGCGGCGGCGGTTGTTGCTCCATTGAAGTAAATTGGACTGCAAATCAGTAATACGGTC
                      ____________________________________________________________
consensus TTGGCGGCGGCGGTTGTTGCTCCATTGAAGTAAATTGGACTGCAAATCAGTAATACGGTC