Previous Contig 006188:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS164B12Sequence625006188 (4)gb:AY085272_15703441e-71Arabidopsis thaliana clone 142354 mRNA, complete sequence.
JMSF024A04Sequence657006188 (4)gb:AY085272_15703441e-78Arabidopsis thaliana clone 142354 mRNA, complete sequence.761012335 (4)gb:AK176177_18181651e-12Arabidopsis thaliana mRNA for 3-beta-hydroxysteroid dehydrogenase, complete cds,
JMSF030B06Sequence689006188 (4)gb:AY085272_15703449e-73Arabidopsis thaliana clone 142354 mRNA, complete sequence.748012335 (4)gb:AK176177_18181657e-09Arabidopsis thaliana mRNA for 3-beta-hydroxysteroid dehydrogenase, complete cds,
JMSF034I13Sequence699006188 (4)gb:AY085272_15703441e-86Arabidopsis thaliana clone 142354 mRNA, complete sequence.718012335 (4)gb:AK176177_18181653e-07Arabidopsis thaliana mRNA for 3-beta-hydroxysteroid dehydrogenase, complete cds,

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030B06+ GAANTCATACATGTTGTTGCCATCACCTATAATGAACTTGGATTTCCCTG
                      ____________________________________________________________
consensus GAANTCATACATGTTGTTGCCATCACCTATAATGAACTTGGATTTCCCTG
 
. : . : . : . : . : . :
JMSF030B06+ CCCTTGCAGCAGTGACAAGGGAAGGAACAAGTAACCTGTCACCGGGGCCAAAAATGCTGC
JMSF034I13+ AAGGAACAAGTAACCTGTCACCGGGGCCAAAAATGCTGC
                      ____________________________________________________________
consensus CCCTTGCAGCAGTGACAAGGGAAGGAACAAGTAACCTGTCACCGGGGCCAAAAATGCTGC
 
. : . : . : . : . : . :
JMSF030B06+ TGGGTCTGATGCAACATGTCAGCAGGCCA-TCTTGCCATTTGCCTTGAGGACTAGTGCCT
JMSF034I13+ TGGGTCTGATGCAACATGTCAGCAGGCCATTCTTGCCATTTGCCTTGAGGACTAGTGCCT
JMFS164B12+ TTGCCCTGAGGACTAGTGCCT
JMSF024A04+ GTCTGATGCAACATGTCAGCAGGCCATTCTTGCCATTTGCCTTGAGGACTAGTGCCT
                      ____________________________________________________________
consensus TGGGTCTGATGCAACATGTCAGCAGGCCATTCTTGCCATTTGCCTTGAGGACTAGTGCCT
 
. : . : . : . : . : . :
JMSF030B06+ CACCTTCAGCTTTAGTTGCAGAATACGAATCGTTGTGCTTATCAGGATATGGCATTGATT
JMSF034I13+ CACCTTCAGCTTTAGTTGCAGAATACGAATCGTTGTGCTTATCAGGATATGGCATTGATT
JMFS164B12+ CACCTTCAGCTTTAGTTGCAGAATACGAATCGTTGTGCTTATCAGGATATGGCATTGATT
JMSF024A04+ CACCTTCAGCTTTAGTTGCAGAATACGAATCGTTGTGCTTATCAGGATATGGCATTGATT
                      ____________________________________________________________
consensus CACCTTCAGCTTTAGTTGCAGAATACGAATCGTTGTGCTTATCAGGATATGGCATTGATT
 
. : . : . : . : . : . :
JMSF030B06+ CATCCCCATTAAAAATTCCATGAACACCATCAAAGACTACACTGGGAGAGCTGGTGTATA
JMSF034I13+ CATCCCCATTAAAAATTCCATGAACACCATCAAAGACTACACTGGGAGAGCTGGTGTATA
JMFS164B12+ CATCCCCATTAAAAATTCCATGAACACCATCAAAGACTACACTGGGAGAGCTGGTGTATA
JMSF024A04+ CATCCCCATTAAAAATTCCATGAACACCATCAAAGACTACACTGGGAGAGCTGGTGTATA
                      ____________________________________________________________
consensus CATCCCCATTAAAAATTCCATGAACACCATCAAAGACTACACTGGGAGAGCTGGTGTATA
 
. : . : . : . : . : . :
JMSF030B06+ TAAGTCTCTTCACTCTTAGCTCAACACAGGCATCAATTATATTCTTAGTTCCTTGTACAT
JMSF034I13+ TAAGTCTCTTCACTCTTAGCTCAACACAGGCATCAATTATATTCTTAGTTCCTTGTACAT
JMFS164B12+ TAAGTCTCTTCACTCTTAGCTCAACACAGGCATCAATTATATTCTTAGTTCCTTGTACAT
JMSF024A04+ TAAGTCTCTTCACTCTTAGCTCAACACAGGCATCAATTATATTCTTAGTTCCTTGTACAT
                      ____________________________________________________________
consensus TAAGTCTCTTCACTCTTAGCTCAACACAGGCATCAATTATATTCTTAGTTCCTTGTACAT
 
. : . : . : . : . : . :
JMSF030B06+ TGACTGAGTGATGGAGCTGGTAGTTGTTGATTGACGAATCTGGGGCAGCCATGTGGAAAA
JMSF034I13+ TGACTGAGTGATGGAGCTGGTAGTTGTTGATTGACGAATCTGGGGCAGCCATGTGGAAAA
JMFS164B12+ TGACTGAGTGATGGAGCTGGTAGTTGTTGATTGACGAATCTGGGGCAGCCATGTGGAAAA
JMSF024A04+ TGACTGAGTGATGGAGCTGGTAGTTGTTGATTGACGAATCTGGGGCAGCCATGTGGAAAA
                      ____________________________________________________________
consensus TGACTGAGTGATGGAGCTGGTAGTTGTTGATTGACGAATCTGGGGCAGCCATGTGGAAAA
 
. : . : . : . : . : . :
JMSF030B06+ CAGCCTCAGCTCCTTCACAAGCTTTGAGTACTTGGGACTTGTCCCGGAGATCCATGGACA
JMSF034I13+ CAGCCTCAGCTCCTTCACAAGCTTTGAGTACTTGGGACTTGTCCCGGAGATCCATGGACA
JMFS164B12+ CAGCCTCAGCTCCTTCACAAGCTTTGAGTACTTGGGACTTGTCCCGGAGATCCATGGACA
JMSF024A04+ CAGCCTCAGCTCCTTCACAAGCTTTGAGTACTTGGGACTTGTCCCGGAGATCCATGGACA
                      ____________________________________________________________
consensus CAGCCTCAGCTCCTTCACAAGCTTTGAGTACTTGGGACTTGTCCCGGAGATCCATGGACA
 
. : . : . : . : . : . :
JMSF030B06+ CATAGANTGCGCGTCCAGATCGGAGTGCTTGGCCGAGAGTGCCATGTTNTTCATGTGGCT
JMSF034I13+ CATAGACTGCGCGTCCAGATCGGAGTGCTTGGCCGAGAGTGCCATGTTCTTCGTGTGGCT
JMFS164B12+ CATAGACTGCGCGTCCAGATCGGAGTGCTTGGCCGAGAGTGCCATGTTCTTCGTGTGGCT
JMSF024A04+ CATAGACTGCGCGTCCAGATCGGAGTGCTTGGCCGAGAGTGCCATGTTCTTCGTGTGGCT
                      ____________________________________________________________
consensus CATAGACTGCGCGTCCAGATCGGAGTGCTTGGCCGAGAGTGCCATGTTCTTCGTGTGGCT
 
. : . : . : . : . : . :
JMSF030B06+ CCAANTTAATTTAAGGACCTAAATCCGCGACCCGAACGGAAAACATGTCGTAGCGAATTA
JMSF034I13+ CCAACTTAATTTCAGGACCTAAATCCGCGACCCGAACGGAAAACATGTCGTAGCGAATTA
JMFS164B12+ CCAACTTAATTTCAGGACCTAAATCCGCGACCCGAACGGAAAACATGTCGTAGCGAATTA
JMSF024A04+ CCAACTTAATTTCAGGACCTAAATCCGCGACCCGAACGGAAAACATGTCGTAGCGAATTA
                      ____________________________________________________________
consensus CCAACTTAATTTCAGGACCTAAATCCGCGACCCGAACGGAAAACATGTCGTAGCGAATTA
 
. : . : . : . : . : . :
JMSF030B06+ GCATTTCCACCAAGTGGCGCGCCGCAAAGCCTCTACCGCCCGTCACCACTGACCATCTCT
JMSF034I13+ GCATTTCCACCAAGTGGCGCGCCGCAAAGCCTCTACCGCCCGTCACCACTGACCATCTCT
JMFS164B12+ GCATTTCCACCAAGTGGCGCGCCGCAAAGCCTCTACCGCCCGTCACCACTGACCATCTCT
JMSF024A04+ GCATTTCCACCAAGTGGCGCGCCGCAAAGCCTCTACCGCCCGTCACCACTGACCATCTCT
                      ____________________________________________________________
consensus GCATTTCCACCAAGTGGCGCGCCGCAAAGCCTCTACCGCCCGTCACCACTGACCATCTCT
 
. : . : . : . : . : . :
JMSF030B06+ CTCCCCCGCTCACCATTGTTACTCTCCAGTAGAATTTG
JMSF034I13+ CTCCCCCGCTCACCATTGTTACTCTCCAGTAGAATTTGCAGAATTTTAACTTCTTATGGA
JMFS164B12+ CTCCCCCGCTCACCATTGTTACTCTCCAGTAGAATTTGCAGAATTTTAACTTCTTATGGA
JMSF024A04+ CTCCCCCGCTCACCATTGTTACTCTCCAGTAGAATTTGCAGAATTTTAACTTCTTATGGA
                      ____________________________________________________________
consensus CTCCCCCGCTCACCATTGTTACTCTCCAGTAGAATTTGCAGAATTTTAACTTCTTATGGA
 
. : . : . : . : . : . :
JMSF034I13+ AGAAATATGAAAGTTTAGTTCAGAACCAGTGGAGCAGTTGAGAACTGAAGATGGTAACTC
JMFS164B12+ AGAAATATGAAAGTTTAGTTCAGAACCAGTGGAGCAGTTGAGAAC
JMSF024A04+ AGAAATATGAAAGTTTAGTTCAGAACCAGTGGAGCAGTTGAGAACTGAAGATGGTAACTC
                      ____________________________________________________________
consensus AGAAATATGAAAGTTTAGTTCAGAACCAGTGGAGCAGTTGAGAACTGAAGATGGTAACTC