Previous Contig 006182:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023O08Sequence694006182 (3)798023096gb:BT012655_16417252e-36Arabidopsis thaliana At1g10120 gene, complete cds.
JMSF037H02Sequence674006182 (3)783013106 (4)pir|T00632|T006322e-12hypothetical protein T27I1.15 - Arabidopsis thaliana>gb:AE005172_890016 Arabidop
JMSF053G23Sequence609006182 (3)860013106 (4)pir|T00632|T006323e-12hypothetical protein T27I1.15 - Arabidopsis thaliana>gb:AE005172_890016 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037H02+ GAGAAGAAAGTACGAAACTTTCAGGGCATAAAGTGGACAATGGGAGAGAAATGAAAGGC
JMSF023O08+ GCATAAAGTGGACAATGGGAGAGAAATGAAAGGC
                      ____________________________________________________________
consensus GAGAAGAAAGTACGAAACTTTCAGGGCATAAAGTGGACAATGGGAGAGAAATGAAAGGC
 
. : . : . : . : . : . :
JMSF037H02+ GTAAGTAACAGCTCACCAGAGGAACAAAAAGAAAGCAGATTCCCTTTCTTTCCCTGATGT
JMSF053G23+ CCCTGATGT
JMSF023O08+ GTAAGTAACAGCTCACCAGAGGAACAAAAAGAAAGCAGATTCCCTTTCTTTCCCTGATGT
                      ____________________________________________________________
consensus GTAAGTAACAGCTCACCAGAGGAACAAAAAGAAAGCAGATTCCCTTTCTTTCCCTGATGT
 
. : . : . : . : . : . :
JMSF037H02+ TTATGCAAACCCCATAAGTGTCATATATTTTCACATCCTCTAATTCAACACTAAACTTGA
JMSF053G23+ TTATGCAAACCCCATAAGTGTCATATATTTTCACATCCTCTAATTCAACACTAAACTTGA
JMSF023O08+ TTATGCAAACCCCATAAGTGTCATATATTTTCACATCCTCTAATTCAACACTAAACTTGA
                      ____________________________________________________________
consensus TTATGCAAACCCCATAAGTGTCATATATTTTCACATCCTCTAATTCAACACTAAACTTGA
 
. : . : . : . : . : . :
JMSF037H02+ TCTTAGCAGGGCTTAAATCTTGTTTTTGAGCTGCACACAATGAGGATCACGCCCTAAACT
JMSF053G23+ TCTTAGCAGGGCTTAAATCTTGTTTTTGAGCTGCACACAATGAGGATCACGCCCTAAACT
JMSF023O08+ TCTTAGCAGGGCTTAAATCTTGTTTTTGAGCTGCACACAATGAGGATCACGCCCTAAACT
                      ____________________________________________________________
consensus TCTTAGCAGGGCTTAAATCTTGTTTTTGAGCTGCACACAATGAGGATCACGCCCTAAACT
 
. : . : . : . : . : . :
JMSF037H02+ AGGTAAAAGAAGCCCCTTTTGGCAGGGAAGAAAAATATACCAATCCTTGTAAAAGAAGCT
JMSF053G23+ AGGTAAAAGAAGCCCCTTTTGGCAGGGAAGAAAAATATACCAATCCTTGTAAAAGAAGCT
JMSF023O08+ AGGTAAAAGAAGCCCCTTTTGGCAGGGAAGAAAAATATACCAATCCTTGTAAAAGAAGCT
                      ____________________________________________________________
consensus AGGTAAAAGAAGCCCCTTTTGGCAGGGAAGAAAAATATACCAATCCTTGTAAAAGAAGCT
 
. : . : . : . : . : . :
JMSF037H02+ TAGAATCAAGACTCAACCAAAACCCCCCACAAGGATCAAGAAAAGCAAAGTCCCAAGGAC
JMSF053G23+ TAGAATCAAGACTCAACCAAAACCCCCCACAAGGATCAAGAAAAGCAAAGTCCCAAGGAC
JMSF023O08+ TAGAATCAAGACTCAACCAAAACCCCCCACAAGGATCAAGAAAAGCAAAGTCCCAAGGAC
                      ____________________________________________________________
consensus TAGAATCAAGACTCAACCAAAACCCCCCACAAGGATCAAGAAAAGCAAAGTCCCAAGGAC
 
. : . : . : . : . : . :
JMSF037H02+ CCTTTTCTAGATATTCTCAATCTGGGTACCCAAAACCATCAAACTACTGGAATTGTGGAG
JMSF053G23+ CCTTTTCTAGATATTCTCAATCTGGGTACCCAAAACCATCAAACTACTGGAATTGTGGAG
JMSF023O08+ CCTTTTCTAGATATTCTCAATCTGGGTACCCAAAACCATCAAACTACTGGAATTGTGGAG
                      ____________________________________________________________
consensus CCTTTTCTAGATATTCTCAATCTGGGTACCCAAAACCATCAAACTACTGGAATTGTGGAG
 
. : . : . : . : . : . :
JMSF037H02+ AGGAAGAGATAAATGAGCGGGGGACCTCACACCCAGACCCTCAAATGGGTTGTTTGATGG
JMSF053G23+ AGGAAGAGATAAATGAGCGGGGGACCTCACACCCAGACCCTCAAATGGGTTGTTTGATGG
JMSF023O08+ AGGAAGAGATAAATGAGCGGGGGACCTCACACCCAGACCCTCAAATGGGTTGTTTGATGG
                      ____________________________________________________________
consensus AGGAAGAGATAAATGAGCGGGGGACCTCACACCCAGACCCTCAAATGGGTTGTTTGATGG
 
. : . : . : . : . : . :
JMSF037H02+ CACTCCCCCTTAAGAATCAAATGCTGGTTCAAATTCCACAAAGAAGTAAATCTATCCACC
JMSF053G23+ CACTCCCCCTTAAGAATCAAATGCTGGTTCAAATTCCACAAAGAAGTAAATCTATCCACC
JMSF023O08+ CACTCCCCCTTAAGAATCAAATGCTGGTTCAAATTCCACAAAGAAGTAAATCTATCCACC
                      ____________________________________________________________
consensus CACTCCCCCTTAAGAATCAAATGCTGGTTCAAATTCCACAAAGAAGTAAATCTATCCACC
 
. : . : . : . : . : . :
JMSF037H02+ CACTGCACTGTGGGCACTTGCAGAAATGGCAAAGAAAGCAAGGATCTTTATAGATCAAAT
JMSF053G23+ CACTGCACTGTGGGCACTTGCAGAAATGGCAAAGAAAGCAAGGATCTTTATAGATCAAAT
JMSF023O08+ CACTGCACTGTGGGCACTTGCAGAAATGGCAAAGAAAGCAAGGATCTTTATAGATCAAAT
                      ____________________________________________________________
consensus CACTGCACTGTGGGCACTTGCAGAAATGGCAAAGAAAGCAAGGATCTTTATAGATCAAAT
 
. : . : . : . : . : . :
JMSF037H02+ TATCCTAAATTACTCCCTAGGGGATAGGTGTGAGAGCAAAGCATATAAAGAATGATGAGA
JMSF053G23+ TATCCTAAATTACTCCCTAGGGGATAGGTGTGAGAGCAAAGCATATAAAGAATGATGAGA
JMSF023O08+ TATCCTAAATTACTCCCTAGGGGATAGGTGTGAGAGCAAAGCATATAAAGAATGATGAGA
                      ____________________________________________________________
consensus TATCCTAAATTACTCCCTAGGGGATAGGTGTGAGAGCAAAGCATATAAAGAATGATGAGA
 
. : . : . : . : . : . :
JMSF037H02+ GAAGAGAAGTTAAC
JMSF053G23+ GAAGAGAAGTTAACAAGGCCGCCGGGTGTTTGGCAATTGGCATCTTTTACCTGCCCAG
JMSF023O08+ GAAGAGAAGTTAACAAGGCCGCCGGGTGTTTGGCAATTGGCATCTTTTACCTGCCCAGTC
                      ____________________________________________________________
consensus GAAGAGAAGTTAACAAGGCCGCCGGGTGTTTGGCAATTGGCATCTTTTACCTGCCCAGTC