Previous Contig 006179:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010J15Sequence588006179 (9)gb:CAR275305_16451919e-78Cicer arietinum mRNA putative enoyl CoA hydratase.694006179 (9)gb:CAR275305_16451913e-83Cicer arietinum mRNA putative enoyl CoA hydratase.
JMFF033M23Sequence568006179 (9)gb:CAR275305_16451911e-75Cicer arietinum mRNA putative enoyl CoA hydratase.583006179 (9)gb:CAR275305_16451913e-66Cicer arietinum mRNA putative enoyl CoA hydratase.
JMFN003J03Sequence611006179 (9)gb:CAR275305_16451914e-76Cicer arietinum mRNA putative enoyl CoA hydratase.
JMFN017P02Sequence608006179 (9)gb:CAR275305_16451913e-78Cicer arietinum mRNA putative enoyl CoA hydratase.
JMSF023O03Sequence649006179 (9)gb:CAR275305_16451914e-82Cicer arietinum mRNA putative enoyl CoA hydratase.711006179 (9)gb:CAR275305_16451914e-91Cicer arietinum mRNA putative enoyl CoA hydratase.
JMSF042D21Sequence611006179 (9)gb:CAR275305_16451915e-50Cicer arietinum mRNA putative enoyl CoA hydratase.750023978gb:AP003487_18298623e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033M23- TTTATTTCTTTTGGAACGGAAGAACATTACAGGACAAT
rJMFF010J15- GGTAGTTTATTTCTTTTGGAACGGAAGAACATTACAGGACAAT
                      ____________________________________________________________
consensus GGTAGTTTATTTCTTTTGGAACGGAAGAACATTACAGGACAAT
 
. : . : . : . : . : . :
JMSF042D21+ AAAAAAAAATCTACAAC
JMFN003J03+ AGAGGATGAATACATCCGAGTTTTATTTTACAATGATGAAGAAAAAAAAATCTACAAC
rJMFF033M23- GAAGAGGATGAATACATCCGAGTTTTATTTTACAATGATGAAGAAAAAAAAATCTACAAC
rJMFF010J15- GAAGAGGATGAATACATCCGAGTTTTATTTTACAATGATGAAGAAAAAAAAATCTACAAC
rJMSF023O03- AGAGGATGAATACATCCGAGTTTTATTTTACAATGATGAAG-AAAAAAAATCTACAAC
                      ____________________________________________________________
consensus GAAGAGGATGAATACATCCGAGTTTTATTTTACAATGATGAAGAAAAAAAAATCTACAAC
 
. : . : . : . : . : . :
JMSF042D21+ TTGGAGGAAGGTTTTTTTGAGCTCCGACTTGCTATGAATTCTTGCATCTTCTGAAATTGC
JMFN003J03+ TTGGAGGAAGGTTTTTTTGAGCTCCGACTTGCTATGAATTCTTGCATCTTCTGAAATTGC
rJMFF033M23- TTGGAGGAAGGTTTTTTTGAGCTCCGACTTGCTATGAATTCTTGCATCTTCTGAAATTGC
rJMFF010J15- TTGGAGGAAGGTTTTTTTGAGCTCCGACTTGCTATGAATTCTTGCATCTTCTGAAATTGC
rJMSF023O03- TTGGAGGAAGGTTTTTTTGAGCTCCGACTTGCTATGAATTCTTGCATCTTCTGAAATTGC
                      ____________________________________________________________
consensus TTGGAGGAAGGTTTTTTTGAGCTCCGACTTGCTATGAATTCTTGCATCTTCTGAAATTGC
 
. : . : . : . : . : . :
JMSF042D21+ TCCTTAGTCATTCCATTATAATACTCATGCGCTCTCTCCTTCTCAAGAGCAAGAGCACGA
JMFN003J03+ TCCTTAGTCATTCCATTATAATACTCATGCGCTCTCTCCTTCTCAAGAGCAAGAGCACGA
rJMFF033M23- TCCTTAGTCATTCCATTATAATACTCATGCGCTCTCTCCTTCTCAAGAGCAAGAGCACGA
rJMFF010J15- TCCTTAGTCATTCCATTATAATACTCATGCGCTCTCTCCTTCTCAAGAGCAAGAGCACGA
rJMSF023O03- TCCTTAGTCATTCCATTATAATACTCATGCGCTCTCTCCTTCTCAAGAGCAAGAGCACGA
                      ____________________________________________________________
consensus TCCTTAGTCATTCCATTATAATACTCATGCGCTCTCTCCTTCTCAAGAGCAAGAGCACGA
 
. : . : . : . : . : . :
JMSF042D21+ TCCAAGTCAAGTTTGAAACCATCATTTATTACTGCCTTGTACCTTAACACCATGTCCTGG
JMFN003J03+ TCCAAGTCAAGTTTGAAACCATCATTTATTACTGCCTTGTACCTTAACACCATGTCCTGG
rJMFF033M23- TCCAAGTCAAGTTTGAAACCATCATTTATTACTGCCTTGTACCTTAACACCATGTCCTGG
rJMFF010J15- TCCAAGTCAAGTTTGAAACCATCATTTATTACTGCCTTGTACCTTAACACCATGTCCTGG
rJMSF023O03- TCCAAGTCAAGTTTGAAACCATCATTTATTACTGCCTTGTACCTTAACACCATGTCCTGG
                      ____________________________________________________________
consensus TCCAAGTCAAGTTTGAAACCATCATTTATTACTGCCTTGTACCTTAACACCATGTCCTGG
 
. : . : . : . : . : . :
JMSF042D21+ TTGTTCTTGATTATTGCTTCTGCAACCTGTCGAGCCTTTTTCAAGAGTTCACTTCTTTCA
JMFN003J03+ TTGTTCTTGATTATTGCTTCTGCAACCTGTCGAGCCTTTTTCAAGAGTTCACTTCTTTCA
rJMFF033M23- TTGTTCTTGATTATTGCTTCTGCAACCTGTCGAGCCTTTTTCAAGAGTTCACTTCTTTCA
rJMFF010J15- TTGTTCTTGATTATTGCTTCTGCAACCTGTCGAGCCTTTTTCAAGAGTTCACTTCTTTCA
rJMSF023O03- TTGTTCTTGATTATTGCTTCTGCAACCTGTCGAGCCTTTTTCAAGAGTTCACTTCTTTCA
JMFN017P02+ TGCAACCTGTCGAGCC-TTTTCAAGAGTTCACTTCTTTCA
JMFF033M23+ A
JMFF010J15+ TTCAAGAGTTCACTTCTTTCA
JMSF023O03+ TATTGCTTCTGCAACCTGTCGAGCCTTTTTCAAGAGTTCACTTCTTTCA
                      ____________________________________________________________
consensus TTGTTCTTGATTATTGCTTCTGCAACCTGTCGAGCCTTTTTCAAGAGTTCACTTCTTTCA
 
. : . : . : . : . : . :
JMSF042D21+ ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
JMFN003J03+ ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
rJMFF033M23- ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
rJMFF010J15- ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
rJMSF023O03- ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
JMFN017P02+ ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTGNTCAGCAGTTAGAGGTGTTGCAGTA
JMFF033M23+ ACAACATGGTTCACAAAACCCAGCNTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
JMFF010J15+ ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
JMSF023O03+ ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
                      ____________________________________________________________
consensus ACAACATGGTTCACAAAACCCAGCCTTTCTGCTTTGTCAGCAGTTAGAGGTGTTGCAGTA
 
. : . : . : . : . : . :
JMSF042D21+ AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
JMFN003J03+ AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
rJMFF033M23- AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
rJMFF010J15- AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
rJMSF023O03- AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
JMFN017P02+ AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
JMFF033M23+ AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
JMFF010J15+ AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
JMSF023O03+ AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
                      ____________________________________________________________
consensus AGTGACACTTCACGAGCTTTGTTGGGCCCTATTACACGTGAAAGCTTCTGAGATAGACCC
 
. : . : . : . : . : . :
JMSF042D21+ CAGGAAGGAAATATCCCAAACCTT
JMFN003J03+ CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTAGCATCGTTGGAAGCA
rJMFF033M23- CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTANCATCGTTGGAAGCA
rJMFF010J15- CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTAGCATCGTTGGAAGCA
rJMSF023O03- CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTAGCATCGTTGGAAGCA
JMFN017P02+ CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTAGCATCGTTGGAAGCA
JMFF033M23+ CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTAGCATCGTTGGAAGCA
JMFF010J15+ CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTAGCATCGTTGGAAGCA
JMSF023O03+ CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTAGCATCGTTGGAAGCA
                      ____________________________________________________________
consensus CAGGAAGGAAATATCCCAAACCTTGCGTGAGTATCCATGAACTTAGCATCGTTGGAAGCA
 
. : . : . : . : . : . :
JMFN003J03+ ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
rJMFF033M23- ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
rJMFF010J15- ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
rJMSF023O03- ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
JMFN017P02+ ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
JMFF033M23+ ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
JMFF010J15+ ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
JMSF023O03+ ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
                      ____________________________________________________________
consensus ACCAATATGTCGCAAGCGAGGGCGATCTCAAAGCCAGCAGTGACAGCAAAACCGGCAATT
 
. : . : . : . : . : . :
JMFN003J03+ GCTCCGATGATTGGTTTAGGGCAGAGTTGCATCTGTGCCACAGGGTCAGCCTCAACGTCC
rJMFF033M23- GCTCC
rJMFF010J15- GCTCCGATGATTGGTTTAGGGCAGAGTTGCATCTGTGCCACAGGGTCAGCCTCAACGTCC
rJMSF023O03- GCTCCGATGATTGGTTTAGGGCAGAGTTGCATCTGTGCCACAGGGTCAGCCTCAACGTCC
JMFN017P02+ GCTCCGATGATTGGTTTAGGGCAGAGTTGCATCTGTGCCACAGGGTCAGCCTCAACGTCC
JMFF033M23+ GCTCCGATGATTGGTTTAGGGCAGAGTTGCATCTGTGCCACAGGGTCAGCCTCAACGTCC
JMFF010J15+ GCTCCGATGATTGGTTTAGGGCAGAGTTGCATCTGTGCCACAGGGTCAGCCTCAACGTCC
JMSF023O03+ GCTCCGATGATTGGTTTAGGGCAGAGTTGCATCTGTGCCACAGGGTCAGCCTCAACGTCC
                      ____________________________________________________________
consensus GCTCCGATGATTGGTTTAGGGCAGAGTTGCATCTGTGCCACAGGGTCAGCCTCAACGTCC
 
. : . : . : . : . : . :
JMFN003J03+ TTGACGTCACCCT
rJMFF010J15- TTGACGTCACCCTTGAAAACATCCTCAGCGGCTGTCAAGTCGACTCCGGAG
rJMSF023O03- TTGACGTCACCCTTGAAAACATCCTCAGCGGCTGTCAAGTCGACTCCGGAGCAGAAAGAA
JMFN017P02+ TTGACGTCACCCTTGAAAACATCCTCAGCGGCTGTCAAGTCGACTCCGGAGCAGAAAGAA
JMFF033M23+ TTGACGTCACCCTTGAAAACATCCTCAGCGGCTGTCAAGTCGACTCCGGAGCAGAAAGAA
JMFF010J15+ TTGACGTCACCCTTGAAAACATCCTCAGCGGCTGTCAAGTCGACTCCGGAGCAGAAAGAA
JMSF023O03+ TTGACGTCACCCTTGAAAACATCCTCAGCGGCTGTCAAGTCGACTCCGGAGCAGAAAGAA
                      ____________________________________________________________
consensus TTGACGTCACCCTTGAAAACATCCTCAGCGGCTGTCAAGTCGACTCCGGAGCAGAAAGAA
 
. : . : . : . : . : . :
rJMSF023O03- GCGCCGGANGCGGTGAGAATGATGACCCGAACCGATTTGTCTGCGCTCAG
JMFN017P02+ GCGCCGGAGGCGGTGAGAATGATGACCCGAACCGATTTGTCTGCGCTCAGAGACTTAAAA
JMFF033M23+ GCGCCGGAGGCGGTGAGAATGATGACCCGAACCGATTTGTCTGCGCTCAGAGACTTAAAA
JMFF010J15+ GCGCCGGAGGCGGTGAGAATGATGACCCGAACCGATTTGTCTGCGCTCAGAGACTTAAAA
JMSF023O03+ GCGCCGGAGGCGGTGAGAATGATGACCCGAACCGATTTGTCTGCGCTCAGAGACTTAAAA
                      ____________________________________________________________
consensus GCGCCGGAGGCGGTGAGAATGATGACCCGAACCGATTTGTCTGCGCTCAGAGACTTAAAA
 
. : . : . : . : . : . :
JMFN017P02+ CCTTGAGCTAGATCCGCCATCATGGCCTTCGTTAAGGAGTTGAGCGACTTAGGTCGGTTT
JMFF033M23+ CCTTGAGCTAGATCCGCCATCATGGCCTTCGTTAAGGAGTTGAGCGACTTAGGTCGGTTT
JMFF010J15+ CCTTGAGCTAGATCCGCCATCATGGCCTTCGTTAAGGAGTTGAGCGACTTAGGTCGGTTT
JMSF023O03+ CCTTGAGCTAGATCCGCCATCATGGCCTTCGTTAAGGAGTTGAGCGACTTAGGTCGGTTT
                      ____________________________________________________________
consensus CCTTGAGCTAGATCCGCCATCATGGCCTTCGTTAAGGAGTTGAGCGACTTAGGTCGGTTT
 
. : . : . : . : . : . :
JMFN017P02+ ATTATGATCCATCCAACGCCGTCGGGGTCGCGATTCACCACGATCAGCTTTTCTGGCACC
JMFF033M23+ ATTATGATCCATCCAACGCCGTCGGGGTCGCGATTCACCACGATCAGCTTTTCTGGCACC
JMFF010J15+ ATTATGATCCATCCAACGCCGTCGGGGTCGCGATTCACCACGATCAGCTTTTCTGGCACC
JMSF023O03+ ATTATGATCCATCCAACGCCGTCGGGGTCGCGATTCACCACGATCAGCTTTTCTGGCACC
                      ____________________________________________________________
consensus ATTATGATCCATCCAACGCCGTCGGGGTCGCGATTCACCACGATCAGCTTTTCTGGCACC
 
. : . : . : . : . : . :
JMFN017P02+ CGGCTCTCCATTTTCTTTTCTCGA
JMFF033M23+ CGGCTCTCCATTTTCTTTTCTCGA
JMFF010J15+ CGGCTCTCCATTTTCTTTTCTCGA
JMSF023O03+ CGGCTCTCCATTTTCTTTTCTCGATTTACAGAATTACAGTACAACAACTATCTATCCTTC
                      ____________________________________________________________
consensus CGGCTCTCCATTTTCTTTTCTCGATTTACAGAATTACAGTACAACAACTATCTATCCTTC