Previous Contig 006177:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002M06Sequence590006177 (10)sp|O82663|DHSA_ARATH8e-64Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3696008623 (9)gb:AP004338_18404161e-96Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P050
JMFF009O15Sequence598006177 (10)sp|O82663|DHSA_ARATH1e-60Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3756008623 (9)gb:AP004338_18404162e-87Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P050
JMFF022H02Sequence521006177 (10)sp|O82663|DHSA_ARATH5e-42Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3450008623 (9)gb:AP004338_18404162e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P050
JMFF033K14Sequence462006177 (10)sp|O82663|DHSA_ARATH3e-38Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3
JMFF038I06Sequence549006177 (10)sp|O82663|DHSA_ARATH3e-56Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3781008623 (9)gb:AP004338_18404161e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P050
JMFF039L11Sequence586006177 (10)sp|O82663|DHSA_ARATH2e-62Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3752008623 (9)gb:AP004338_18404163e-87Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P050
JMFF049B05Sequence633006177 (10)sp|O82663|DHSA_ARATH4e-71Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3613008623 (9)gb:AP004338_18404161e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P050
JMFS162C02Sequence535006177 (10)sp|O82663|DHSA_ARATH2e-50Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3
JMSF023N21Sequence599006177 (10)sp|O82663|DHSA_ARATH2e-57Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3784008623 (9)sp|O82663|DHSA_ARATHe-133Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3
JMSF039E23Sequence711006177 (10)sp|O82663|DHSA_ARATH6e-88Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3856008623 (9)sp|O82663|DHSA_ARATHe-119Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (EC 1.3

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039E23+ GAACTGCGTATTATGNTTCATAGCCTGCCCA
                      ____________________________________________________________
consensus GAACTGCGTATTATGNTTCATAGCCTGCCCA
 
. : . : . : . : . : . :
JMFF049B05+ TATGCT
JMSF039E23+ TAGAGAGTATGCAACAAAGCATGTCCAGTCCGATCAGCAGCACAGGCACAGCGGTATGCT
                      ____________________________________________________________
consensus TAGAGAGTATGCAACAAAGCATGTCCAGTCCGATCAGCAGCACAGGCACAGCGGTATGCT
 
. : . : . : . : . : . :
JMFF049B05+ TGTCCGCCTTTTCCAAAATTTAGACTGTGGCCACCAAATGCACGTTGATATATTTTCCCA
JMFF039L11+ CCAAATGCACGTTGATATATTTTCCCA
JMFF002M06+ CCACCAAATGCACGTTGATATATTTTCCCA
JMSF039E23+ TGTCCGCCTTTTCCAAAATTTAGACTTTGGCCACCAAATGCACGTTGATATATTTTCCCA
JMFF009O15+ CGTTGATATATTTTCCCA
                      ____________________________________________________________
consensus TGTCCGCCTTTTCCAAAATTTAGACTTTGGCCACCAAATGCACGTTGATATATTTTCCCA
 
. : . : . : . : . : . :
JMFF049B05+ TCTTCAGTTCGAGAGAATGGCAGCCCATAGTTCTCAAGCTCTATGACTGCTTTTGGAGCT
JMFF039L11+ TCTTCAGTTCGAGAGAATGGCAGCCCATAGTTCTCAAGCTCTATGACTGCTTTTGGAGCT
JMFF038I06+ GTTCGAGAGAATGGCAGCCCATAGTTCTCAAGCTCTATGACTGCTTTTGGAGCT
JMFF002M06+ TCTTCAGTTCGAGAGAATGGCAGCCCATAGTTCTCAAGCTCTATGACTGCTTTTGGAGCT
JMSF039E23+ TCTTCAGTTCGAGAGAATGGCAGCCCATAGTTCTCAAGCTCTATGACTGCTTTTGGAGCT
JMFS162C02+ TCAAGCTCTATGACTGCTTTTGGAGCT
JMFF009O15+ TCTTCAGTTCGAGAGAATGGCAGCCCATAGTTCTCAAGCTCTATGACTGCTTTTGGAGCT
JMSF023N21+ CTTCAGTTCGAGAGAATGGCAGCCCATAGTTCTCAAGCTCTATGACTGCTTTTGGAGCT
                      ____________________________________________________________
consensus TCTTCAGTTCGAGAGAATGGCAGCCCATAGTTCTCAAGCTCTATGACTGCTTTTGGAGCT
 
. : . : . : . : . : . :
JMFF049B05+ TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
JMFF039L11+ TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
JMFF038I06+ TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
JMFF002M06+ TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
JMFF033K14+ TAGCCAATCACTTCCTTTAACAGTA
JMSF039E23+ TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
JMFS162C02+ TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
JMFF009O15+ TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
JMFF022H02+ TGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
JMSF023N21+ TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
                      ____________________________________________________________
consensus TCTCTACACATATACTGAATAGCATCCTGATCACCTAGCCAATCACTTCCTTTAACAGTA
 
. : . : . : . : . : . :
JMFF049B05+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTACTAGTGCAGCATTTATACCA
JMFF039L11+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
JMFF038I06+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
JMFF002M06+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
JMFF033K14+ TCATACATGTGCCACCTCCAATCATCNTCAGTCATATTTACTAGTGCAGCATTTATACCA
JMSF039E23+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
JMFS162C02+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
JMFF009O15+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
JMFF022H02+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
JMSF023N21+ TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
                      ____________________________________________________________
consensus TCATACATGTGCCACCTCCAATCATCCTCAGTCATATTTCCTAGTGCAGCATTTATACCA
 
. : . : . : . : . : . :
JMFF049B05+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMFF039L11+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMFF038I06+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMFF002M06+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMFF033K14+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMSF039E23+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMFS162C02+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMFF009O15+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMFF022H02+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
JMSF023N21+ CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
                      ____________________________________________________________
consensus CCCTGAGCGGCAACCGTGTGAGAACGAGTTGGAAAGAGCTTGGTAATACAAGCAGTGTTG
 
. : . : . : . : . : . :
JMFF049B05+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
JMFF039L11+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
JMFF038I06+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
JMFF002M06+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
JMFF033K14+ AATCCATGCTCAGACAACCCAATTGCTGCTNTAAGCCNTGCACCTCCTGCACCTACCACC
JMSF039E23+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
JMFS162C02+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
JMFF009O15+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
JMFF022H02+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
JMSF023N21+ AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
                      ____________________________________________________________
consensus AATCCATGCTCAGACAACCCAATTGCTGCTCTAAGCCCTGCACCTCCTGCACCTACCACC
 
. : . : . : . : . : . :
JMFF049B05+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMFF039L11+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMFF038I06+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMFF002M06+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMFF033K14+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMSF039E23+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMFS162C02+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMFF009O15+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMFF022H02+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
JMSF023N21+ ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
                      ____________________________________________________________
consensus ACTGCATCATATGTGTGATCCACTACCGTATAGGATGACCCTCCCACATTAGCTTGAGTA
 
. : . : . : . : . : . :
JMFF049B05+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMFF039L11+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMFF038I06+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMFF002M06+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMFF033K14+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMSF039E23+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMFS162C02+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMFF009O15+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMFF022H02+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
JMSF023N21+ GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
                      ____________________________________________________________
consensus GAGAAAAGGCGCTGTAAATGGGAGTCGCCGGAGATGGATCTCTTGGAACCAATGCGAAGT
 
. : . : . : . : . : . :
JMFF049B05+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
JMFF039L11+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
JMFF038I06+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
JMFF002M06+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
JMFF033K14+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATNGAATATGTATGATTTGTG
JMSF039E23+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
JMFS162C02+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
JMFF009O15+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
JMFF022H02+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
JMSF023N21+ CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
                      ____________________________________________________________
consensus CCACGCGACACGCAGCGCCACATCTCTCACCGATTTCGAATCGAATATGTATGATTTGTG
 
. : . : . : . : . : . :
JMFF049B05+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMFF039L11+ TCTGCGACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMFF038I06+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMFF002M06+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMFF033K14+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMSF039E23+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMFS162C02+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMFF009O15+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMFF022H02+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
JMSF023N21+ TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
                      ____________________________________________________________
consensus TCTGCAACTGCGACTGGTTTAGCTCAGGAGATCGAATATGCGGGTTGGGAAGACGAAGAA
 
. : . : . : . : . : . :
JMFF049B05+ GAAGAAGAAGAA
JMFF039L11+ GAAGAAGAAGAAGATGTTC
JMFF038I06+ GAAGAAGAAGAAGAT
JMFF002M06+ GAAGAAGAAGAAGATGTTC
JMFF033K14+ GAAGAAGAAGAA
JMSF039E23+ GAAGAAGAAGAAGATGTTC
JMFS162C02+ GAAGAAGAAGAAGATGTTCAAAAGCTAA
JMFF009O15+ GAAGAAGAAGAAGATGTTCAAAAGCTAACGCGACAAATGT
JMFF022H02+ GAAGAAGAAGAAGATGTTCAAAAGCTAACGCGACAAATGTGGAGACTAGAAATACT
JMSF023N21+ GAAGAAGAAGAAGATGTTCAAAAGCTAACGCGACAAATGTGGAGACTAGAAATACTATCC
                      ____________________________________________________________
consensus GAAGAAGAAGAAGATGTTCAAAAGCTAACGCGACAAATGTGGAGACTAGAAATACTATCC