Previous Contig 006173:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011H20Sequence494006173 (27)gb:AY246274_15925732e-32Capsicum annuum PF1 mRNA, complete cds.750006173 (27)gb:AY286010_15947825e-36Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF012F01Sequence395006173 (27)gb:AY286010_15947823e-18Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF014A07Sequence381006173 (27)gb:AY246274_15925735e-13Capsicum annuum PF1 mRNA, complete cds.784006173 (27)gb:AY286010_15947823e-45Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF022B01Sequence732006173 (27)gb:AY529642_16118672e-37Capsicum annuum ethylene-responsive factor-like protein 1 (ERFLP1) mRNA, complet
JMFF022D16Sequence428006173 (27)gb:AY246274_15925734e-18Capsicum annuum PF1 mRNA, complete cds.
JMFF023O03Sequence490006173 (27)gb:AY246274_15925732e-32Capsicum annuum PF1 mRNA, complete cds.
JMFF030M06Sequence537006173 (27)gb:AY246274_15925738e-40Capsicum annuum PF1 mRNA, complete cds.724006173 (27)gb:AY286010_15947822e-35Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF037B05Sequence542006173 (27)gb:AY286010_15947821e-34Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.762006173 (27)gb:AY286010_15947828e-34Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF037E06Sequence561006173 (27)gb:AY246274_15925736e-37Capsicum annuum PF1 mRNA, complete cds.762006173 (27)gb:AY286010_15947823e-41Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF038O11Sequence566006173 (27)gb:AY246274_15925731e-43Capsicum annuum PF1 mRNA, complete cds.725006173 (27)gb:AY286010_15947822e-66Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF040N24Sequence150006173 (27)gb:AY286010_15947822e-10Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.775006173 (27)gb:AY286010_15947821e-42Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF046L16Sequence455006173 (27)gb:AY246274_15925738e-24Capsicum annuum PF1 mRNA, complete cds.544021767gb:OSJN00003_16931138e-27Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16, complete seque
JMFF051M24Sequence609006173 (27)gb:AY286010_15947826e-51Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.517006173 (27)gb:AY044235_15610182e-15Lycopersicon esculentum transcription factor JERF1 (JERF1) mRNA, complete cds.
JMSF004K08Sequence382006173 (27)gb:AY286010_15947827e-14Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.386006173 (27)gb:AY044235_15610181e-15Lycopersicon esculentum transcription factor JERF1 (JERF1) mRNA, complete cds.
JMSF008M22Sequence272006173 (27)gb:AY246274_15925733e-10Capsicum annuum PF1 mRNA, complete cds.756006173 (27)gb:AY286010_15947823e-45Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMSF023M13Sequence582006173 (27)gb:AY286010_15947825e-18Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.758006173 (27)gb:AY286010_15947822e-68Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF051M24- AGCACAATACATTCAAGCAACTTTCATAATACACATCACATAATAAG
rJMFF037B05- ATCACATAATAAG
                      ____________________________________________________________
consensus AGCACAATACATTCAAGCAACTTTCATAATACACATCACATAATAAG
 
. : . : . : . : . : . :
rJMFF051M24- AAGCAATTCGTTGGCGATCATCCTCCACAGAAACATTTAAATGGACGACGACTCAACAGT
rJMFF037B05- AAGCAATTCGTTGGCGATCATCCTCCACAGAAACATTTAAATGGACGACGACTCAACAGT
rJMFF011H20- TTTAAATGGACGACGACTCAACAGT
rJMFF040N24- T
rJMFF014A07- AGT
                      ____________________________________________________________
consensus AAGCAATTCGTTGGCGATCATCCTCCACAGAAACATTTAAATGGACGACGACTCAACAGT
 
. : . : . : . : . : . :
rJMFF051M24- GTTTATTAAGGTTTCTTTAAATGCAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
rJMFF037B05- GTTTATTAAGGTTTCTTTAAATGCAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
rJMFF030M06- TTAAGGTTTCTTTAAATGCAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
rJMSF004K08- ACCATCATCCTAGCACCAGCAGGNCTACAACC
rJMFF011H20- GTTTATTAAGGTTTCTTTAAATGCAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
rJMFF040N24- GTTTATTAAGGTTTCTTTAAATGCAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
rJMFF037E06- TTAAGGTTTCTTTAAATGCAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
rJMSF008M22- CAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
rJMFF014A07- GTTTATTAAGGTTTCTTTAAATGCAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
                      ____________________________________________________________
consensus GTTTATTAAGGTTTCTTTAAATGCAGACACCATCATCCTAGCACCAGCAGG-CTACAACC
 
. : . : . : . : . : . :
rJMFF051M24- ACAAACAAACCTCCTATAAGAAAAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
rJMFF037B05- ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
rJMFF030M06- ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
rJMSF004K08- ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
rJMFF011H20- ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
rJMFF040N24- ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
rJMFF037E06- ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
rJMSF008M22- ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
rJMFF014A07- ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
                      ____________________________________________________________
consensus ACAAACAAACCTCCTATAAGAACAAGGAGGAAAAAGAGGGAATTAAACAATAATCCTATT
 
. : . : . : . : . : . :
rJMFF051M24- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMFF037B05- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMFF030M06- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMSF004K08- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMFF011H20- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMFF040N24- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMFF037E06- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMSF008M22- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMFF014A07- TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
rJMFF038O11- ATATCATCAATAAGTCTTTACTCA
                      ____________________________________________________________
consensus TTATCCTCCATATGCAGTTAATAAAAATACAGGACAATATCATCAATAAGTCTTTACTCA
 
. : . : . : . : . : . :
rJMFF051M24- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMFF037B05- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMFF030M06- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMSF004K08- CATTATGACNTGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMFF011H20- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMFF040N24- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMFF037E06- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMSF008M22- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMFF014A07- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMFF038O11- CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMSF023M13- TGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
rJMFF022B01- TGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
                      ____________________________________________________________
consensus CATTATGACATGATGATGATGATTATATACAACACAAACCAGAAAGGGGATGGATGCTCT
 
. : . : . : . : . : . :
rJMFF051M24- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMFF037B05- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMFF030M06- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMSF004K08- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMFF011H20- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMFF040N24- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMFF037E06- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMSF008M22- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMFF014A07- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMFF038O11- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMSF023M13- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
rJMFF022B01- GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
                      ____________________________________________________________
consensus GCATTTGCATCAGTTTATCTAGTAGATCTAGTAGACATCCCCCATTAAAGAAGGAACATC
 
. : . : . : . : . : . :
rJMFF051M24- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMFF037B05- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMFF030M06- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMSF004K08- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAANGTAAGTGTCAACTGA
rJMFF011H20- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMFF040N24- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMFF037E06- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATAAGCATTAAGGTAAGTGTCAACTGA
rJMSF008M22- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMFF014A07- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMFF038O11- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMSF023M13- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
rJMFF022B01- ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
                      ____________________________________________________________
consensus ATCAAATGACCAGAGATCTATGGCGTTTCCACCATCAGCATTAAGGTAAGTGTCAACTGA
 
. : . : . : . : . : . :
rJMFF051M24- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATC
rJMFF037B05- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMFF030M06- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMSF004K08- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTC
rJMFF011H20- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMFF040N24- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMFF037E06- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMSF008M22- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMFF014A07- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMFF038O11- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMSF023M13- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
rJMFF022B01- TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
                      ____________________________________________________________
consensus TGAGTCCCAGTTTCCCTCCAGATATGGGATCTGAAGGAACTTCATCTCATCTTCAAAAGC
 
. : . : . : . : . : . :
rJMFF037B05- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMFF030M06- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMFF011H20- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMFF040N24- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMFF037E06- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMSF008M22- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMFF014A07- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMFF038O11- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMSF023M13- TGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
rJMFF022B01- CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
                      ____________________________________________________________
consensus CGAGAGCTCTTCAGACAGCTTCTCAACCGTGTTTTCCGTAGACTTCAGTTTCTTTTGTGG
 
. : . : . : . : . : . :
rJMFF037B05- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMFF030M06- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMFF011H20- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMFF040N24- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMFF037E06- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMSF008M22- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMFF014A07- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMFF038O11- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMSF023M13- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
rJMFF022B01- GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
                      ____________________________________________________________
consensus GTTGGTTTCCTGAATGAACTGAATCTCATCAGCAGCTTCAACAGCAGCCGACAGAGCAGA
 
. : . : . : . : . : . :
rJMFF037B05- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMFF030M06- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMFF011H20- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMFF040N24- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMFF037E06- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMSF008M22- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMFF014A07- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMFF038O11- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMSF023M13- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
rJMFF022B01- GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
                      ____________________________________________________________
consensus GGATATCTCTGGAGTCTGCTCTCCCCACCCATAATCAGTACAGTCCAAGGAATTCACAGG
 
. : . : . : . : . : . :
rJMFF037B05- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
rJMFF030M06- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
rJMFF011H20- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
rJMFF040N24- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTTACCTTGACAGCGCGCCTTGA
JMFF040N24+ AGAAACCGCCTTCCGTGGATTTACCTTGACAGCGCGCCTTGA
rJMFF037E06- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
rJMSF008M22- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
rJMFF014A07- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
rJMFF038O11- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
rJMSF023M13- CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
rJMFF022B01- CGGTTTTTGGACAGTCTTAG-AACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
                      ____________________________________________________________
consensus CGGTTTTTGGACAGTCTTAGAAACCGCCTTCCGTGGATTCACCTTGACAGCGCGCCTTGA
 
. : . : . : . : . : . :
rJMFF037B05- CGATTTTGTTTGAGTTTCAGCATCAGCAGG
rJMFF030M06- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
rJMFF011H20- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
rJMFF040N24- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
JMFF040N24+ CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
rJMFF037E06- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
rJMSF008M22- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
rJMFF014A07- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
rJMFF038O11- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
rJMSF023M13- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
rJMFF022B01- CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
JMFF051M24+ CATCAGCAGGGAAATTCANCTTAGCTTNGTTGCCTCTGAT
                      ____________________________________________________________
consensus CGATTTTGTTTGAGTTTCAGCATCAGCAGGGAAATTCAACTTAGCTTTGTTGCCTCTGAT
 
. : . : . : . : . : . :
rJMFF030M06- CCTC
rJMFF011H20- CCTCCG
rJMFF040N24- CCTCCGAGCCTCAGTATCATANGCTCTCGCCGCTTCTTCAGC
JMFF040N24+ CCTCCGAGCCTCAGTATCATAGGCTCTCGCCGCTTCTTCAGC
rJMFF037E06- CCTCCGAGCCTCAGTATCATAGGCTCTCGCCGCTTCTTCAGCA
rJMSF008M22- CCTCCGAGCCTCAGTATCATAGGCTCTCGCCGCTTCTTCAGCAGTGTCGAAGGTTCCTAG
rJMFF014A07- CCTCCGAGCCTCAGTATCATANGCTCTCGCCGCTTCTTCAGCAGTGTCGAAAGTTCCTAG
rJMFF038O11- CCTCCGAGCCTCAGTATCATAGGCTCTCGCCGCTTCTTCAGCAGTGTCGAAAGTTCCTAG
rJMSF023M13- CCTCCGAGCCTCAGTATCATAGGCTCTCGCCGCTTCTTCAGCAGTGTCGAAAGTTCCTAG
rJMFF022B01- CCTCCGAGCCTCAGTATCATAGGCTCTCGCCGCTTCTTCAGCAGTGTCGAAAGTTCCTAG
JMFF051M24+ CCTCCGAGCCTCAGTATCATAGGCTCTCGCCGCTTCTTCAGCAGTGTCGAAAGTTCCTAG
JMFF037E06+ CAGTATCATAGGCTCTCGCCGNTTCTTCAGCAGTGTCGAAAGTTCCTAG
JMFF030M06+ TCTTCAGCAGTGTCGAAAGTTCCTAG
JMFF038O11+ CCTCAGTATCATAGGCTCTCGCCGCTTNTTCAGCAGTGTCGAAAGTTCCTAG
JMFF037B05+ CTTCTTCAGCAGTGTCGAAAGTTCCTAG
                      ____________________________________________________________
consensus CCTCCGAGCCTCAGTATCATAGGCTCTCGCCGCTTCTTCAGCAGTGTCGAAAGTTCCTAG
 
. : . : . : . : . : . :
rJMFF014A07- CC
rJMFF038O11- CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
rJMSF023M13- CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
rJMFF022B01- CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
JMFF051M24+ CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
JMFF037E06+ CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
JMFF030M06+ CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
JMFF038O11+ CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
JMFF037B05+ CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
JMFF023O03+ CGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
JMFF046L16+ GACG
JMFF011H20+ TCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
                      ____________________________________________________________
consensus CCAGACTCGAACACCTTTACTCGGATCACGGATTTCAGCCGCCCATTTGCCCCAAGGACG
 
. : . : . : . : . : . :
rJMFF038O11- CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCA
rJMSF023M13- CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAANGTCCTT
rJMFF022B01- CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
JMFF051M24+ CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
JMFF037E06+ CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
JMFF030M06+ CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
JMFF038O11+ CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
JMFF037B05+ CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
JMFF023O03+ CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
JMFF046L16+ CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
JMFF022D16+ TCTTCATAGTTTGGTCAAAGTCCTT
JMFF012F01+ CCTT
JMFF011H20+ CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
                      ____________________________________________________________
consensus CTGCCTGATCCCCCTGTACTGATTTTTCCTCTTTCTCTTCATAGTTTGGTCAAAGTCCTT
 
. : . : . : . : . : . :
rJMSF023M13- AGAATCCGAGCTGAAACC
rJMFF022B01- AGAATCCGAGCTGAAACCGGAAG
JMFF051M24+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMFF037E06+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCTNTTA
JMFF030M06+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMFF014A07+ AACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCTGGTA
JMFF038O11+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMFF037B05+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-NTA
JMFF023O03+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMFF046L16+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMFF022D16+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMFF012F01+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMFF011H20+ AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMSF004K08+ GAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
JMSF023M13+ ACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
                      ____________________________________________________________
consensus AGAATCCGAGCTGAAACCGGAAGAGAGTCCGAAAGCGAAGGGTTTGACATCCACCT-CTA
 
. : . : . : . : . : . :
JMFF051M24+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF037E06+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF030M06+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF014A07+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF038O11+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF037B05+ CGACCCCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF023O03+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF046L16+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF022D16+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF012F01+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMFF011H20+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMSF004K08+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
JMSF023M13+ CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
                      ____________________________________________________________
consensus CGACCTCATCATCATCATAGTCATTGAAGTCCTGAAAATCAGCCTCGAATTCATTATCGA
 
. : . : . : . : . : . :
JMFF051M24+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF037E06+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF030M06+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF014A07+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF038O11+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF037B05+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF023O03+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF046L16+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF022D16+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF012F01+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMFF011H20+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMSF008M22+ AAAAGCCGAGGATCGCAGGCNTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
JMSF004K08+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTG-AAAATTCTTCTTCT
JMSF023M13+ GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
                      ____________________________________________________________
consensus GGTCAAAAGCCGAGGATCGCAGGCCTCCGGAATAGTAGCTTCCTGCAAAATTCTTCTTCT
 
. : . : . : . : . : . :
JMFF051M24+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF037E06+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF030M06+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF014A07+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF038O11+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF037B05+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF023O03+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF046L16+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF022D16+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF012F01+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMFF011H20+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMSF008M22+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMSF004K08+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
JMSF023M13+ TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
                      ____________________________________________________________
consensus TCTTCCCACCTGCGCTGCTCCGATCAGCGATTCCCCATAGCAACTCAGAGGTCAGCCGGC
 
. : . : . : . : . : . :
JMFF051M24+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCCAACT
JMFF037E06+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF030M06+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF014A07+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF038O11+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF037B05+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF023O03+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF046L16+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF022D16+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF012F01+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMFF011H20+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMSF008M22+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMSF004K08+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
JMSF023M13+ GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
                      ____________________________________________________________
consensus GCGACGTCCGGGCCGGCGGTTTGATATCGGAGATTATAGCACCACCGCACATCTCTAACT
 
. : . : . : . : . : . :
JMFF051M24+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF037E06+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF030M06+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF014A07+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF038O11+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF037B05+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF023O03+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF046L16+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF022D16+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF012F01+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMFF011H20+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMSF008M22+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMSF004K08+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
JMSF023M13+ TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
                      ____________________________________________________________
consensus TTCTAGCTTGAAATCAAAAGACAAACTATTCGCAGAGATTTTTTCTTCGCAAAAAAAGCA
 
. : . : . : . : . : . :
JMFF051M24+ ATTTCGATTGAGAAAATTTGGTAGTTTTTA
JMFF037E06+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACC
JMFF030M06+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACC
JMFF014A07+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACCA
JMFF038O11+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACCAGT
JMFF037B05+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACCAGT
JMFF023O03+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACC
JMFF046L16+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACC
JMFF022D16+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACCAGT
JMFF012F01+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACC
JMFF011H20+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACCAGT
JMSF008M22+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACCAGT
JMSF004K08+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACCAGT
JMSF023M13+ ATTTCGATTGAGAAAATTTGGTAGTTTTTACCAGTGAAGTTTCAGATGCAGCATTGGCTC
                      ____________________________________________________________
consensus ATTTCGATTGAGAAAATTTGGTAGTTTTTACCAGTGAAGTTTCAGATGCAGCATTGGCTC