Previous Contig 006170:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021M24Sequence528006170 (5)pir|S20876|S208767e-67chaperonin hsp60 precursor - Arabidopsis thaliana>gb:ATCHHSP60_1544175 A.thalian690012323 (5)gb:AE016959_10229742e-72Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMFF042P16Sequence652006170 (5)pir|S20876|S208762e-83chaperonin hsp60 precursor - Arabidopsis thaliana>gb:ATCHHSP60_1544175 A.thalian658012323 (5)gb:AE016959_10229742e-47Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMSF016C10Sequence228006170 (5)gb:AY136360_15818613e-12Arabidopsis thaliana mitochondrial chaperonin HSP60 (At2g33210) mRNA, complete c727012323 (5)gb:AE016959_10229748e-76Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMSF023M09Sequence639006170 (5)pir|S20876|S208762e-85chaperonin hsp60 precursor - Arabidopsis thaliana>gb:ATCHHSP60_1544175 A.thalian791012323 (5)gb:AE016959_10229741e-73Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMSF025A15Sequence678006170 (5)pir|S20876|S208761e-82chaperonin hsp60 precursor - Arabidopsis thaliana>gb:ATCHHSP60_1544175 A.thalian768012323 (5)gb:AE016959_10229745e-82Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025A15+ CTCCATAGCCTTGCAATCA
                      ____________________________________________________________
consensus CTCCATAGCCTTGCAATCA
 
. : . : . : . : . : . :
JMSF025A15+ ACTCACCAATTCTCTTTCCCCATTTGCGGAAATTGTACCAACCTGTGCAATTTCTTCTGA
JMFF042P16+ TTGTACCAACCTGTGCAATTTCTTCTGA
JMSF023M09+ ATTTGCGGAAATTGTACCAACCTGTGCAATTTCTTCTGA
                      ____________________________________________________________
consensus ACTCACCAATTCTCTTTCCCCATTTGCGGAAATTGTACCAACCTGTGCAATTTCTTCTGA
 
. : . : . : . : . : . :
JMSF025A15+ TGTACTTATCATCCGTGCTCTG-TCTTCAGGTTTGTGACCACAGAATCAACAGCCATGGT
JMFF042P16+ TGTACTTATCATCCGTGCTCTGCTCTTCAGGTTTGTGACCACAGAATCAACAGCCATGGT
JMSF023M09+ TGTACTTATCATCCGTGCTCTGCTCTTCAGGTTTGTGACCACAGAATCAACAGCCATGGT
                      ____________________________________________________________
consensus TGTACTTATCATCCGTGCTCTGCTCTTCAGGTTTGTGACCACAGAATCAACAGCCATGGT
 
. : . : . : . : . : . :
JMSF025A15+ GATACCACGTCTAAGATCCATTGCATTCATGCCAGCTGCAACTGACTTACAGCCTTCAGC
JMFF021M24+ TAAGATCCATTGCATTCATGCCAGCTGCAACTGACTTACAGCCTTCAGC
JMFF042P16+ GATACCACGTCTAAGATCCATTGCATTCATGCCAGCTGCAACTGACTTACAGCCTTCAGC
JMSF023M09+ GATACCACGTCTAAGATCCATTGCATTCATGCCAGCTGCAACTGACTTACAGCCTTCAGC
                      ____________________________________________________________
consensus GATACCACGTCTAAGATCCATTGCATTCATGCCAGCTGCAACTGACTTACAGCCTTCAGC
 
. : . : . : . : . : . :
JMSF025A15+ AAATATAGCCCGTGTGAGGACAGTTGCACAAGTGGTACCATCACCAGCAACATCATTAGT
JMFF021M24+ AAATATAGCCCGTGTGAGGACAGTTGCACAAGTGGTACCATCACCAGCAACATCATTAGT
JMFF042P16+ AAATATAGCCCGTGTGAGGACAGTTGCACAAGTGGTACCATCACCAGCAACATCATTAGT
JMSF023M09+ AAATATAGCCCGTGTGAGGACAGTTGCACAAGTGGTACCATCACCAGCAACATCATTAGT
                      ____________________________________________________________
consensus AAATATAGCCCGTGTGAGGACAGTTGCACAAGTGGTACCATCACCAGCAACATCATTAGT
 
. : . : . : . : . : . :
JMSF025A15+ AGCATTAGCAACCTGCTTTACCAGGCTCGCACCAACATTCTTCACTTTGTTGTTGAATTC
JMFF021M24+ AGCATTAGCAACCTGCTTTACCAGGCTCGCACCAACATTCTTCACTTTGTTGTTGAATTC
JMFF042P16+ AGCATTAGCAACCTGCTTTACCAGGCTCGCACCAACATTCTTCACTTTGTTGTTGAATTC
JMSF023M09+ AGCATTAGCAACCTGCTTTACCAGGCTCGCACCAACATTCTTCACTTTGTTGTTGAATTC
                      ____________________________________________________________
consensus AGCATTAGCAACCTGCTTTACCAGGCTCGCACCAACATTCTTCACTTTGTTGTTGAATTC
 
. : . : . : . : . : . :
JMSF025A15+ AACACTTTTTGCAACTGTGACACCATCTTTTGTTACTTTAGGGGCACCCCAACTTTGTTC
JMFF021M24+ AACACTTTTTGCAACTGTGACACCATCTTTTGTTACTTTAGGGGCACCCCAACTTTGTTC
JMFF042P16+ AACACTTTTTGCAACTGTGACACCATCTTTTGTTACTTTAGGGGCACCCCAACTTTGTTC
JMSF023M09+ AACACTTTTTGCAACTGTGACACCATCTTTTGTTACTTTAGGGGCACCCCAACTTTGTTC
                      ____________________________________________________________
consensus AACACTTTTTGCAACTGTGACACCATCTTTTGTTACTTTAGGGGCACCCCAACTTTGTTC
 
. : . : . : . : . : . :
JMSF025A15+ AATAACAACATTACGTCCCTTGGGACCCATAGTAACTTTAACTGCATCAGCAAGTTCTTC
JMFF021M24+ AATAACAACATTACGTCCCTTGGGACCCATAGTAACTTTAACTGCATCAGCAAGTTCTTC
JMFF042P16+ AATAACAACATTACGTCCCTTGGGACCCATAGTAACTTTAACTGCATCAGCAAGTTCTTC
JMSF023M09+ AATAACAACATTACGTCCCTTGGGACCCATAGTAACTTTAACTGCATCAGCAAGTTCTTC
                      ____________________________________________________________
consensus AATAACAACATTACGTCCCTTGGGACCCATAGTAACTTTAACTGCATCAGCAAGTTCTTC
 
. : . : . : . : . : . :
JMSF025A15+ TACACCCTGAAGCATCAAGGCCCGAGCCTCCACTCCAAATCTAATATCCTTAGCAGCATA
JMSF016C10+ TGAAGCATCAAGGCCCGAGCCTCCACTCCAAATCTAATATCCTTAGCAGCATA
JMFF021M24+ TACACCCTGAAGCATCAAGGCCCGAGCCTCCACTCCAAATCTAATATCCTTAGCAGCATA
JMFF042P16+ TACACCCTGAAGCATCAAGGCCCGAGCCTCCACTCCAAATCTAATATCCTTAGCAGCATA
JMSF023M09+ TACACCCTGAAGCATCAAGGCCCGAGCCTCCACTCCAAATCTAATATCCTTAGCAGCATA
                      ____________________________________________________________
consensus TACACCCTGAAGCATCAAGGCCCGAGCCTCCACTCCAAATCTAATATCCTTAGCAGCATA
 
. : . : . : . : . : . :
JMSF025A15+ ATTTCTGCTCCAGCCTAACCTACTACCAACCTGCTGGGAGCTGCTTTTCGCAACCCTGGC
JMSF016C10+ ATTTCTGCTCCAGCCTAACCTACTACCAACCTGCTGGGAGCTGCTTTTCGCAACCCTGGC
JMFF021M24+ ATTTCTGCTCCAGCCTAACCTACTACCAACCTGCTGGGAGCTGCTTTTCGCAACCCTGGC
JMFF042P16+ ATTTCTGCTCCAGCCTAACCTACTACCAACCTGCTGGGAGCTGCTTTTCGCAACCCTGGC
JMSF023M09+ ATTTCTGCTCCAGCCTAACCTACTACCAACCTGCTGGGAGCTGCTTTTCGCAACCCTGGC
                      ____________________________________________________________
consensus ATTTCTGCTCCAGCCTAACCTACTACCAACCTGCTGGGAGCTGCTTTTCGCAACCCTGGC
 
. : . : . : . : . : . :
JMSF025A15+ TTTGGAGGCAATGTTCGATAAGAAACGATGCATGATTTATGTATTGATAATGAGTAGATA
JMSF016C10+ TTTGGAGGCAATGTTCGATAAGAAACGATGCATGATTTATGTATTGATAATGAGTAGATA
JMFF021M24+ TTTGGAGGCAATGTTCGATAAGAAACGATGCATGATTTATGTATTGATAATGAGTAGATA
JMFF042P16+ TTTGGAGGCAA
JMSF023M09+ TTTGGAGGCAATGTTCGATAAGAAACGATGCATGATTTATGTATTGATAATGAGTAGATA
                      ____________________________________________________________
consensus TTTGGAGGCAATGTTCGATAAGAAACGATGCATGATTTATGTATTGATAATGAGTAGATA
 
. : . : . : . : . : . :
JMSF025A15+ CGCTTCGTCAGAGTTTGTCAATGAGGAAGCGCACAGAAAGAAAGAAGAGAGTAGAGATC
JMSF016C10+ CGCTTCGTCAGAGTTTGTCAATGAGGAAGCGCACAGAAAGAAAGAAGAGAGTAG
JMFF021M24+ CGCTTCGTCAGAGTTTGTCAATGAGGAAGCGCACAGAAAGAAAGAAGAGAGTAGAGATC
JMSF023M09+ CGCTTCGTCAGAGTTTGTCAATGAGGAAGCGCACAGAAAGAAAGAAGAGAGTAGAGATCC
                      ____________________________________________________________
consensus CGCTTCGTCAGAGTTTGTCAATGAGGAAGCGCACAGAAAGAAAGAAGAGAGTAGAGATCC