Previous Contig 006158:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023F01Sequence268006158 (2)678009297 (2)gb:AY084279_15693716e-56Arabidopsis thaliana clone 10216 mRNA, complete sequence.>gb:AF168391_1774090 Ar
JMSF023J16Sequence649006158 (2)651023089gb:OSJN00039_16937265e-04Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032I19, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023F01+ TTTTTTTTTTGTCAAGGCACTTCTTTTAGCAGACAGAAAGTTGAAGGAAACCACCA
JMSF023J16+ TTTGTCAAGGCACTTCTTTTAGCAGACAGAAAGTTGAAGGAAACCACCA
                      ____________________________________________________________
consensus TTTTTTTTTTGTCAAGGCACTTCTTTTAGCAGACAGAAAGTTGAAGGAAACCACCA
 
. : . : . : . : . : . :
JMFF023F01+ ATTTCACAGGGGAAGGGTGAAATATGGCAAAAAGAAGAATGTAGACACAACTCCAGAAAT
JMSF023J16+ ATTTCACAGGGGAAGGGTGAAATATGGCAAAAAGAAGAATGTAGACACAACTCCAGAAAT
                      ____________________________________________________________
consensus ATTTCACAGGGGAAGGGTGAAATATGGCAAAAAGAAGAATGTAGACACAACTCCAGAAAT
 
. : . : . : . : . : . :
JMFF023F01+ ATCCACATCAAACTCCAAGGTGAGGGGGCCAAACAAGAAGCACGGCTACTACAAAT
JMSF023J16+ ATCCACATCAAACTCCAAGGTGAGGGGGCCAAACAAGAAGCACGGCTACTCCAAATCTAT
                      ____________________________________________________________
consensus ATCCACATCAAACTCCAAGGTGAGGGGGCCAAACAAGAAGCACGGCTACTCCAAATCTAT
 
. : . : . : . : . : . :
JMSF023J16+ AACATTCAACAGGTTGGAATATTAGCATCAGAATCAAATAACTGTATTGATTATATTGCA
                      ____________________________________________________________
consensus AACATTCAACAGGTTGGAATATTAGCATCAGAATCAAATAACTGTATTGATTATATTGCA
 
. : . : . : . : . : . :
JMSF023J16+ GTTTAAGAAACAAAATGAAACCAGGGAGTACTGAAGAACAGAAAAAAGAATACGGGCATT
                      ____________________________________________________________
consensus GTTTAAGAAACAAAATGAAACCAGGGAGTACTGAAGAACAGAAAAAAGAATACGGGCATT
 
. : . : . : . : . : . :
JMSF023J16+ ACATCAAACAATGGCAGAGCAAAAAATTTCACAGAAAAAGAAAAACAAAATTCAGATATT
                      ____________________________________________________________
consensus ACATCAAACAATGGCAGAGCAAAAAATTTCACAGAAAAAGAAAAACAAAATTCAGATATT
 
. : . : . : . : . : . :
JMSF023J16+ GGCACATATCAAATAGCTGTAGAATGGAAGAATTCGCACACTAGGAGAAAATGAAAATGA
                      ____________________________________________________________
consensus GGCACATATCAAATAGCTGTAGAATGGAAGAATTCGCACACTAGGAGAAAATGAAAATGA
 
. : . : . : . : . : . :
JMSF023J16+ TGACAATCGAACTCCCCAAATTCTTCAGCATCAATCAAACACGTAAAAATCAGTTATAAA
                      ____________________________________________________________
consensus TGACAATCGAACTCCCCAAATTCTTCAGCATCAATCAAACACGTAAAAATCAGTTATAAA
 
. : . : . : . : . : . :
JMSF023J16+ CAAACACCCATATATACGCAAGAGGATGCACGTAAGCTCGAATCGCTATACATGATCCAC
                      ____________________________________________________________
consensus CAAACACCCATATATACGCAAGAGGATGCACGTAAGCTCGAATCGCTATACATGATCCAC
 
. : . : . : . : . : . :
JMSF023J16+ AAAAGGTGGAAATTGGGCGGCGAGCTCGACGTAGTAAAGACGGAAAGTGGGCATAAACAC
                      ____________________________________________________________
consensus AAAAGGTGGAAATTGGGCGGCGAGCTCGACGTAGTAAAGACGGAAAGTGGGCATAAACAC
 
. : . : . : . : . : . :
JMSF023J16+ TTACTTAAAATAAGCTCTCACTCTCTCTCTCGGGATTAATGGCAGAAAAACCAACGGTCC
                      ____________________________________________________________
consensus TTACTTAAAATAAGCTCTCACTCTCTCTCTCGGGATTAATGGCAGAAAAACCAACGGTCC