Previous Contig 006151:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H24Sequence537006151 (10)pir|F86296|F862961e-44hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido693010036 (9)pir|F86296|F862963e-57hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF019D09Sequence542006151 (10)pir|F86296|F862966e-56hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido715010036 (9)pir|F86296|F862967e-60hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF019N22Sequence539006151 (10)pir|F86296|F862962e-62hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido722010036 (9)pir|F86296|F862961e-57hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF020M04Sequence545006151 (10)pir|F86296|F862967e-63hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido691010036 (9)pir|F86296|F862962e-57hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF022B03Sequence501006151 (10)pir|F86296|F862966e-63hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido701010036 (9)pir|F86296|F862966e-61hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF039I24Sequence580006151 (10)pir|F86296|F862965e-68hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido741010036 (9)pir|F86296|F862963e-61hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFS027A07Sequence595006151 (10)pir|F86296|F862963e-66hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMSF023I12Sequence674006151 (10)pir|F86296|F862962e-68hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido740010036 (9)pir|F86296|F862963e-61hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMSF024M20Sequence636006151 (10)pir|F86296|F862967e-71hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido740010036 (9)pir|F86296|F862965e-73hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMSF044A23Sequence728006151 (10)pir|F86296|F862964e-89hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido738010036 (9)pir|F86296|F862964e-59hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044A23+ ATNTTGTCCAGATGGAGCA
                      ____________________________________________________________
consensus ATNTTGTCCAGATGGAGCA
 
. : . : . : . : . : . :
JMSF044A23+ AAGAAATGAAAAAGAACTCCAGTGATGGCAAAAGTTGCCACATAACATACAAGTGAAACA
                      ____________________________________________________________
consensus AAGAAATGAAAAAGAACTCCAGTGATGGCAAAAGTTGCCACATAACATACAAGTGAAACA
 
. : . : . : . : . : . :
JMSF044A23+ ACAAGCAAGGCCACATACCAGAACTGCTCATCATATCCAACCCATTTGTCATTCCATCCA
JMSF024M20+ ATCCAACCCATTTGTCATTCCATCCA
JMFS027A07+ TTCCATCCA
JMSF023I12+ TTCCATCCA
                      ____________________________________________________________
consensus ACAAGCAAGGCCACATACCAGAACTGCTCATCATATCCAACCCATTTGTCATTCCATCCA
 
. : . : . : . : . : . :
JMSF044A23+ TGGACAAAGTCCAACAAAAGGACAACTTGAACAAGAAGAAACAATCCTGAACCAAACTTC
JMSF024M20+ TGGACAAAGTCCAACAAAAGGACAACTTGAACAAGAAGAAACAATCCTGAACCAAACTTC
JMFS027A07+ TGGACAAAGTCCAACAAAAGGACAACTTGAACAAGAAGAAACAATCCTGAACCAAACTTC
JMFF039I24+ AACAAGAAGAAACAATCCTGAACCAAACTTC
JMSF023I12+ TGGACAAAGTCCAACAAAAGGACAACTTGAACAAGAAGAAACAATCCTGAACCAAACTTC
                      ____________________________________________________________
consensus TGGACAAAGTCCAACAAAAGGACAACTTGAACAAGAAGAAACAATCCTGAACCAAACTTC
 
. : . : . : . : . : . :
JMSF044A23+ GAAGTTGACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
JMSF024M20+ GAAGTTGACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
JMFS027A07+ GAAGTTGACTCATAAAAGCTGATGAGCTCATATGGAACAAAAAACATAAATATTACTAAA
JMFF039I24+ GAAGTTGACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
JMFF019N22+ GACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
JMFF022B03+ TTGACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
JMFF020M04+ TTGACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
JMFF019D09+ GACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
JMFF010H24+ ACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
JMSF023I12+ GAAGTTGACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
                      ____________________________________________________________
consensus GAAGTTGACTCATAAAAGCTGATGAGCTCATTTGGAACAAAAAACATAAATATTACTAAA
 
. : . : . : . : . : . :
JMSF044A23+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMSF024M20+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMFS027A07+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMFF039I24+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMFF019N22+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMFF022B03+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMFF020M04+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMFF019D09+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMFF010H24+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
JMSF023I12+ AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
                      ____________________________________________________________
consensus AGGAACCAGCAGATGACTTTCATCATCCATCCACCATGGTGCAAATTATCACGAGGGTCC
 
. : . : . : . : . : . :
JMSF044A23+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMSF024M20+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMFS027A07+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMFF039I24+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMFF019N22+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMFF022B03+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMFF020M04+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMFF019D09+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMFF010H24+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
JMSF023I12+ TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
                      ____________________________________________________________
consensus TTCTGATTCTTTATACCAATCATCATGATTGATAGGATGGTAAAGAACGTGAAGTTTCCC
 
. : . : . : . : . : . :
JMSF044A23+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
JMSF024M20+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
JMFS027A07+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
JMFF039I24+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
JMFF019N22+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
JMFF022B03+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
JMFF020M04+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
JMFF019D09+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAA-CATTCCCTATCTGGTGTTTTGTGGAAA
JMFF010H24+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
JMSF023I12+ AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
                      ____________________________________________________________
consensus AAGCTAACTCGAAGTACTGCATCTGTTTCAAACCATTCCCTATCTGGTGTTTTGTGGAAA
 
. : . : . : . : . : . :
JMSF044A23+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
JMSF024M20+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
JMFS027A07+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
JMFF039I24+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
JMFF019N22+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
JMFF022B03+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
JMFF020M04+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
JMFF019D09+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
JMFF010H24+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGC-ACTTCTCGAAGAATCCATGAA
JMSF023I12+ TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
                      ____________________________________________________________
consensus TGATTAATCCATGGGATATTCTCCATGAGAGGAGCAGCAACTTCTCGAAGAATCCATGAA
 
. : . : . : . : . : . :
JMSF044A23+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMSF024M20+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMFS027A07+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMFF039I24+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMFF019N22+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMFF022B03+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMFF020M04+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMFF019D09+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMFF010H24+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
JMSF023I12+ ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
                      ____________________________________________________________
consensus ACAATCAGCGACAGCCCAAAAAGACCACAGTATGCAATACGAGCGGAGCGGCGGCTGATC
 
. : . : . : . : . : . :
JMSF044A23+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMSF024M20+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMFS027A07+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMFF039I24+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMFF019N22+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMFF022B03+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMFF020M04+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMFF019D09+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMFF010H24+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
JMSF023I12+ CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
                      ____________________________________________________________
consensus CCTGACACCACCGTCCGGCAGGCATCACAGGCGCACGCAGCACAGCATGACGCAAGGCAA
 
. : . : . : . : . : . :
JMSF044A23+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
JMSF024M20+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
JMFS027A07+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
JMFF039I24+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
JMFF019N22+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
JMFF022B03+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
JMFF020M04+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
JMFF019D09+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
JMFF010H24+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAG----TCCTTGCTGCGGTTGCGG
JMSF023I12+ GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
                      ____________________________________________________________
consensus GAAGCTGCCCACATATTCAGAAAACTCTCCTATTCCAGTCCTTCCTTGCTGCGGTTGCGG
 
. : . : . : . : . : . :
JMSF044A23+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTC
JMSF024M20+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCTTCGACAAAAGATGA
JMFS027A07+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCT
JMFF039I24+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCTTCGACAAAAGATGA
JMFF019N22+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCTTCGACAAAAGATGA
JMFF022B03+ ATGAAGAGAAGAATAACAGGATATC
JMFF020M04+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCTTCGACAAAAGATGA
JMFF019D09+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCTTCGACAAAAGATGA
JMFF010H24+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCTTCGACAAAAGATGA
JMSF023I12+ ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCTTCGACAAAAGATGA
                      ____________________________________________________________
consensus ATGAAGAGAAGAATAACAGGGTATCACTTTTCGACAATGCGTTTCTTCGACAAAAGATGA
 
. : . : . : . : . : . :
JMSF024M20+ GAGAGAGA
JMFF039I24+ GAGAGAGAT
JMFF019N22+ GAGAG
JMFF020M04+ GAGAGAGAT
JMFF019D09+ GAGAGAGAT
JMFF010H24+ GAGAGAGAT
JMSF023I12+ GAGAGAGATAGAGAGAAAGAGGCACGGTTCAAACTTATGCTTTGGTGAGTCAAAAGTCCT
                      ____________________________________________________________
consensus GAGAGAGATAGAGAGAAAGAGGCACGGTTCAAACTTATGCTTTGGTGAGTCAAAAGTCCT