Previous Contig 006146:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS093F04Sequence631006146 (4)gb:AB096857_15258767e-15Prunus avium SFB3 mRNA for S-locus F-Box protein 3, complete cds.
JMSF011O15Sequence212006146 (4)gb:AC151815_17451522e-05Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence.734022461
JMSF023H23Sequence657006146 (4)gb:AB096857_15258768e-15Prunus avium SFB3 mRNA for S-locus F-Box protein 3, complete cds.782023080gb:AY363975_16028107e-06Petunia integrifolia subsp. inflata S3 self-incompatibility locus-linked putativ
JMSF046N15Sequence734006146 (4)gb:AB101441_15262977e-19Prunus mume SFB7 mRNA for S-locus F-Box protein 7, complete cds.764024229gb:AY500392_16096642e-04Petunia integrifolia subsp. inflata S3-locus linked F-box protein (SLF) mRNA, SL

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046N15+ TTCCAATGTACTGCTCCATTA
                      ____________________________________________________________
consensus TTCCAATGTACTGCTCCATTA
 
. : . : . : . : . : . :
JMSF046N15+ ACAAAAACCTGAGTACAACTGTAATCGAAAATATCGTAGTTAACCCCAGTTGCTGTTATC
                      ____________________________________________________________
consensus ACAAAAACCTGAGTACAACTGTAATCGAAAATATCGTAGTTAACCCCAGTTGCTGTTATC
 
. : . : . : . : . : . :
JMSF046N15+ CTTTTCCACACCCCAGTGCTGAGAGAATAGATCTCAACCAAAGGTGGTGTGACTGGTCCT
                      ____________________________________________________________
consensus CTTTTCCACACCCCAGTGCTGAGAGAATAGATCTCAACCAAAGGTGGTGTGACTGGTCCT
 
. : . : . : . : . : . :
JMSF046N15+ ATATCCAAAGTAACACCTTTCCTTTCATACACAAGTCTCACCACCTTAAGATCATCATCA
JMFS093F04+ AACACCTTTTCTTTCATACACAACTCTCACCACCTTAAGATCATCATCA
JMSF023H23+ AACACCTTTTCTTTCATACACAACTCTCACCACCTTAAGATCATCATCA
                      ____________________________________________________________
consensus ATATCCAAAGTAACACCTTTTCTTTCATACACAACTCTCACCACCTTAAGATCATCATCA
 
. : . : . : . : . : . :
JMSF046N15+ CTTCGTGGACTAGCACCGAATCCAAGTACAAACCTAGATGGGTGAGCTGGCCTAATATAG
JMFS093F04+ CTTAGTGGACTAGCACCGAATCCAAGTACAAACCTAAATGGGTAAGCTGGCCTAATAGAG
JMSF023H23+ CTTAGTGGACTAGCACCGAATCCAAGTACAAACCTAAATGGGTAAGCTGGCCTAATAGAG
                      ____________________________________________________________
consensus CTTAGTGGACTAGCACCGAATCCAAGTACAAACCTAAATGGGTAAGCTGGCCTAATAGAG
 
. : . : . : . : . : . :
JMSF046N15+ TGATAAGGTAAGATCCTAGCCTGCCGAATACTGGGATTCCACAGGCGTACAGTAGCCATA
JMFS093F04+ GGACAAGGTAAGGCCCTAAGCTTCCGAATACTGGGATTCCACAGGGTTACAGTATGCCAA
JMSF023H23+ GGACAAGGTAAGGCCCTAAGCTTCCGAATACTGGGATTCCACAGGGTTACAGTATGCCAA
                      ____________________________________________________________
consensus GGACAAGGTAAGGCCCTAAGCTTCCGAATACTGGGATTCCACAGGGTTACAGTATGCCAA
 
. : . : . : . : . : . :
JMSF046N15+ TTATTAAAATAATCATCCGATAAACAAAGGACGCCGTTATAGAAGCCAACTGTATAAAAA
JMFS093F04+ TCACTAAAATAATCATCCGATAAACAAAAGACGCCGTTATAGAAACCAACTGTACGAAAA
JMSF023H23+ TCACTAAAATAATCATCCGATAAACAAAAGACGCCGTTATAGAAACCAACTGTACGAAAA
                      ____________________________________________________________
consensus TCACTAAAATAATCATCCGATAAACAAAAGACGCCGTTATAGAAACCAACTGTACGAAAA
 
. : . : . : . : . : . :
JMSF046N15+ TACCCGTTTCCGAATGAAACTGGGAGGTCGAGTTCGAAGGAATTATTGAGGGTGAGCAAT
JMFS093F04+ TACCCGATTCCGCATGAAATTGGGAAGCTGAGTTGGAAGGAATTATCGAGGGTGAGTAAT
JMSF023H23+ TACCCGATTCCGCATGAAATTGGGAAGCTGAGTTGGAAGGAATTATCGAGGGTGAGTAAT
                      ____________________________________________________________
consensus TACCCGATTCCGCATGAAATTGGGAAGCTGAGTTGGAAGGAATTATCGAGGGTGAGTAAT
 
. : . : . : . : . : . :
JMSF046N15+ TGGTGGTCAGTGTCGTTGAGTACGGAATATTTTTCCTCTATGTAGGATTTATCATAACGT
JMFS093F04+ TGGTGGTCAGTGTCGTCGAGTACGGAATATTTTTCCTCATTGTAGGATTTGTCATAACGT
JMSF023H23+ TGGTGGTCAGTGTCGTCGAGTACGGAATATTTTTCCTCATTGTAGGATTTGTCATAACGT
                      ____________________________________________________________
consensus TGGTGGTCAGTGTCGTCGAGTACGGAATATTTTTCCTCATTGTAGGATTTGTCATAACGT
 
. : . : . : . : . : . :
JMSF046N15+ CGGAGGAGGAGGAGGTTAGTGGCGGAGTTACCGTTCCTATGGTGGCGGCAATGGACGGAG
JMFS093F04+ CGGAGGAGGAGGAGATTAGTGGCGGAGTTACCGTTCCTATGGTGGCGGCGATGGGCGGAG
JMSF011O15+ CGGAG
JMSF023H23+ CGGAGGAGGAGGAGATTAGTGGCGGAGTTACCGTTCCTATGGTGGCGGCGATGGGCGGAG
                      ____________________________________________________________
consensus CGGAGGAGGAGGAGATTAGTGGCGGAGTTACCGTTCCTATGGTGGCGGCGATGGGCGGAG
 
. : . : . : . : . : . :
JMSF046N15+ ATGAAGGCGGGGCTGGTGATGAGGAAGTACCACGATTTGGAAACGGCGGTGAAGCGTACA
JMFS093F04+ ATGAAGGCGGGGCTGGTGATGATGAAGTACCACGATTTGGAAACGGCGGTGAAGCGTAGA
JMSF011O15+ ATGAAGGCGGGGCTGGTGATGAGGAAGTACCACGATTTGGAAACGGCGGTGAAGCGTACA
JMSF023H23+ ATGAAGGCGGGGCTGGTGATGATGAAGTACCACGATTTGGAAACGGCGGTGAAGCGTAGA
                      ____________________________________________________________
consensus ATGAAGGCGGGGCTGGTGATGATGAAGTACCACGATTTGGAAACGGCGGTGAAGCGTAGA
 
. : . : . : . : . : . :
JMSF046N15+ AGGGACTTCACTGGGAGCCTTTTGAGGATTTGGATCTGGAGTTCCTCCGGAAAATGGTGG
JMFS093F04+ AGGGACTTGACTGGGAGCCTTTTGAGGATTTCGATCAGGAGTTCCTCCGGAAAATGGTGG
JMSF011O15+ AGGGACTTCACTGGGAGCCTTTTGAGGATTTGGATCTGGAGTTCCTCCGGAAAATGGTGG
JMSF023H23+ AGGGACTTGACTGGGAGCCTTTTGAGGATTTCGATCAGGAGTTCCTCCGGAAAATGGTGG
                      ____________________________________________________________
consensus AGGGACTTGACTGGGAGCCTTTTGAGGATTTGGATCTGGAGTTCCTCCGGAAAATGGTGG
 
. : . : . : . : . : . :
JMSF046N15+ TGATCAGACATTGTTCAATTTGGAAATTTGAGTCTGCAACTTGTGAGCACGT
JMFS093F04+ TGATCAGACATTGTTCAATTTGGAAATTTGAGTCTGCAACTTGTGAGCACGT
JMSF011O15+ TGATCAGACATTGTTCAATTTGGAAATTTGAGTCTGCAACTTGTGAGCACGTAACCCTAA
JMSF023H23+ TGATCAGACATTGTTCAATTTGGAAATTTGAGTCTGCAACTTGTGAGCACGTAACCCTAA
                      ____________________________________________________________
consensus TGATCAGACATTGTTCAATTTGGAAATTTGAGTCTGCAACTTGTGAGCACGTAACCCTAA
 
. : . : . : . : . : . :
JMSF011O15+ C
JMSF023H23+ CTCTACCGTTAAGAAAGTCGAAGATGATAACCCGCGGACGGCAAGCCCAGAATGTAATCC
                      ____________________________________________________________
consensus CTCTACCGTTAAGAAAGTCGAAGATGATAACCCGCGGACGGCAAGCCCAGAATGTAATCC