Previous Contig 006145:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS090F03Sequence622006145 (8)pir|D84823|D848234e-27hypothetical protein At2g39950 [imported] - Arabidopsis thaliana>gb:AF002109_176
JMFS092H02Sequence615006145 (8)pir|D84823|D848234e-26hypothetical protein At2g39950 [imported] - Arabidopsis thaliana>gb:AF002109_176
JMFS150A07Sequence535006145 (8)pir|D84823|D848232e-13hypothetical protein At2g39950 [imported] - Arabidopsis thaliana>gb:AF002109_176
JMSF003I22Sequence324006145 (8)680012250 (3)gb:AP005869_18593241e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B102
JMSF005A10Sequence257006145 (8)278011380 (6)
JMSF022G09Sequence641006145 (8)pir|D84823|D848234e-27hypothetical protein At2g39950 [imported] - Arabidopsis thaliana>gb:AF002109_176736012250 (3)gb:AP005869_18593245e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B102
JMSF023H18Sequence649006145 (8)pir|D84823|D848239e-27hypothetical protein At2g39950 [imported] - Arabidopsis thaliana>gb:AF002109_176667012250 (3)gb:AP005869_18593247e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B102
JMSF030N10Sequence647006145 (8)pir|D84823|D848233e-28hypothetical protein At2g39950 [imported] - Arabidopsis thaliana>gb:AF002109_176383023447pir|D84823|D848231e-08hypothetical protein At2g39950 [imported] - Arabidopsis thaliana>gb:AF002109_176

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030N10+ TTCCAACACGCACTGAAACCAGAGGAATGCACAAGCATCTGGCCAGGATAC
JMSF022G09+ ACGCACTGAAACCAGAGGAATGCACAAGCATCTGGCCAGGATAC
JMFS092H02+ CTGAAACCAGAGGAATGCACAAGCATCTGGCCAGGATAC
JMFS090F03+ ACGCACTGAAACCAGAGGAATGCACAAGCATCTGGCCAGGATAC
JMSF023H18+ ACGCACTGAAACCAGAGGAATGCACAAGCATCTGGCCAGGATAC
                      ____________________________________________________________
consensus TTCCAACACGCACTGAAACCAGAGGAATGCACAAGCATCTGGCCAGGATAC
 
. : . : . : . : . : . :
JMSF030N10+ CAACCTCTGCCGGATCAAAGTGCTGACTGAGATAAGCGAGTAAGCAATCCTCCGCGGCAC
JMSF022G09+ CAACCTCTGCCGGATCAAAGTGCTGACTGAGATAAGCGAGTAAGCAATCCTCCGCGGCAC
JMFS092H02+ CAACCTCTGCCGGATCAAAGTGCTGACTGAGATAAGCGAGTAAGCAATCCTCCGCGGCAC
JMFS150A07+ AGCGAGTAAGCAATCCTCCGCGGCAC
JMFS090F03+ CAACCTCTGCCGGATCAAAGTGCTGACTGAGATAAGCGAGTAAGCAATCCTCCGCGGCAC
JMSF023H18+ CAACCTCTGCCGGATCAAAGTGCTGACTGAGATAAGCGAGTAAGCAATCCTCCGCGGCAC
                      ____________________________________________________________
consensus CAACCTCTGCCGGATCAAAGTGCTGACTGAGATAAGCGAGTAAGCAATCCTCCGCGGCAC
 
. : . : . : . : . : . :
JMSF030N10+ CGGTGGAGACATTCATCTTCAACAAAGGCTTCAGCCTCTCATCGGCTCGACACGCGCCCA
JMSF022G09+ CGGTGGAGACATTCATCTTCAACAAAGGCTTCAGCCTCTCATCGGCTCGACACGCGCCCA
JMFS092H02+ CGGTGGAGACATTCATCTTCAACAAAGGCTTCAGCCTCTCATCGGCTCGACACGCGCCCA
JMFS150A07+ CGGTGGAGACATTCATCTTCAACAAAGGCTTCAGCCTCTCATCGGCTCGACACGCGCCCA
JMFS090F03+ CGGTGGAGACATTCATCTTCAACAAAGGCTTCAGCCTCTCATCGGCTCGACACGCGCCCA
JMSF023H18+ CGGTGGAGACATTCATCTTCAACAAAGGCTTCAGCCTCTCATCGGCTAGACACGCGCCCA
                      ____________________________________________________________
consensus CGGTGGAGACATTCATCTTCAACAAAGGCTTCAGCCTCTCATCGGCTCGACACGCGCCCA
 
. : . : . : . : . : . :
JMSF030N10+ TCACCTGCATATCCAGAGCCTGAAGCCACTGAAAAACACTGCCTTCTCGATCGCTCCGTT
JMSF022G09+ TCACCTGCATATCCAGAGCCTGAAGCCACTGAAAAACACTGCCTTCTCGATCGCTCCGTT
JMFS092H02+ TCACCTGCATATCCAGAGCCTGAAGCCACTGAAAAACACTGCCTTCTCGATCGCTCCGTT
JMFS150A07+ TCACCTGCATATCCAGAGCCTGAAGCCACTGAAAAACACTGCCTTCTCGATCGCTCCGTT
JMFS090F03+ TCACCTGCATATCCAGAGCCTGAAGCCACTGAAAAACACTGCCTTCTCGATCGCTCCGTT
JMSF023H18+ TCACCTGCATATCCAGAGCCTGAAGCCACTGAAAAACACTGCCTTCTCGATCGCTCCGTT
                      ____________________________________________________________
consensus TCACCTGCATATCCAGAGCCTGAAGCCACTGAAAAACACTGCCTTCTCGATCGCTCCGTT
 
. : . : . : . : . : . :
JMSF030N10+ GAAGCAATAGATCTCCATCGCCGTCCTCCACCAGGATCTCCGTCAACCTCTCCACAAGCC
JMSF022G09+ GAAGCAATAGATCTCCATCGCCGTCCTCCACCAGGATCTCCGTCAACCTCTCCACAAGCC
JMFS092H02+ GAAGCAATAGATCTCCATCGCCGTCCTCCACCAGGATCTCCGTCAACCTCTCCACAAGCC
JMFS150A07+ GAAGCAATAGATCTCCATCGCCGTCCTCCACCAGGATCTCCGTCAACCTCTCCACAAGCC
JMFS090F03+ GAAGCAATAGATCTCCATCGCCGTCCTCCACCAGGATCTCCGTCAACCTCTCCACAAGCC
JMSF023H18+ GAAGCAATAGATCTCCATCGCCGTCCTCCACCAGGATCTCCGTCAACCTCTCCACAAGCC
                      ____________________________________________________________
consensus GAAGCAATAGATCTCCATCGCCGTCCTCCACCAGGATCTCCGTCAACCTCTCCACAAGCC
 
. : . : . : . : . : . :
JMSF030N10+ CCGAGCTCCCTCGGCTAACTCCACCTTCCGTCGCAGTACCGCCCGTCTCGGTCCCTTCAA
JMSF003I22+ GCAGTACCGCCCGTCTCGGTCCCTTCAA
JMSF022G09+ CCGAGCTCCCTCGGCTAACTCCACCTTCCGTCGCAGTACCGCCCGTCTCGGTCCCTTCAA
JMFS092H02+ CCGAGCTCCCTCGGCTAACTCCACCTTCCGTCGCAGTACCGCCCGTCTCGGTCCCTTCAA
JMFS150A07+ CCGAGCTCCCTCGGCTAACTCCACCTTCCGTCGCAGTACCGCCCGTCTCGGTCCCTTCAA
JMFS090F03+ CCGAGCTCCCTCGGCTAACTCCACCTTCCGTCGCAGTACCGCCCGTCTCGGTCCCTTCAA
JMSF023H18+ CCGAGCTCCCTCGGCTAACTCCACCTTCCGTCGCAGTACCGCCCGTCTCGGTCCCTTCAA
                      ____________________________________________________________
consensus CCGAGCTCCCTCGGCTAACTCCACCTTCCGTCGCAGTACCGCCCGTCTCGGTCCCTTCAA
 
. : . : . : . : . : . :
JMSF030N10+ TTGCGTGACCACCGATAGAATCCTCAACACCATCCATCTCCCGATCGTTCAACGATTGTT
JMSF003I22+ TTGCGTGACCACCGATAGAATCCTCAACACCATCCATCTCCCGATCGTTCAACGATTGTT
JMSF005A10+ CCCGATCGTTCAACGATTGTT
JMSF022G09+ TTGCGTGACCACCGATAGAATCCTCAACACCATCCATCTCCCGATCGTTCAACGATTGTT
JMFS092H02+ TTGCGTGACCACCGATAGAATCCTCAACACCATCCATCTCCCGATCGTTCAACGATTGTT
JMFS150A07+ TTGCGTGACCACCGATAGAATCCTCAACACCATCCATCTCCCGATCGTTCAACGATTGTT
JMFS090F03+ TTGCGTGACCACCGATAGAATCCTCAACACCATCCATCTCCCGATCGTTCAACGATTGTT
JMSF023H18+ TTGCGTGACCACCGATAGAATCCTCAACACCATCCATCTCCCGATCGTTCAACGATTGTT
                      ____________________________________________________________
consensus TTGCGTGACCACCGATAGAATCCTCAACACCATCCATCTCCCGATCGTTCAACGATTGTT
 
. : . : . : . : . : . :
JMSF030N10+ TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
JMSF003I22+ TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
JMSF005A10+ TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
JMSF022G09+ TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
JMFS092H02+ TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
JMFS150A07+ TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
JMFS090F03+ TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
JMSF023H18+ TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
                      ____________________________________________________________
consensus TCTTCTCACCATTAACCATTTTAATTCTCAGATTAGAATATTAGATTAATTATGTTCAAA
 
. : . : . : . : . : . :
JMSF030N10+ TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
JMSF003I22+ TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
JMSF005A10+ TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
JMSF022G09+ TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
JMFS092H02+ TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
JMFS150A07+ TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
JMFS090F03+ TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
JMSF023H18+ TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
                      ____________________________________________________________
consensus TCCCCGACCCGCCCCGCTACCAACAAATTGCAATCGAGATCGTTGCAACGCTCAATCCGA
 
. : . : . : . : . : . :
JMSF030N10+ TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
JMSF003I22+ TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
JMSF005A10+ TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
JMSF022G09+ TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
JMFS092H02+ TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
JMFS150A07+ TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
JMFS090F03+ TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
JMSF023H18+ TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
                      ____________________________________________________________
consensus TACTCTAATTCAATTCCGATCGTAACAAAACTTTGGATCTCGGCCTCTCGGAGATAGAAG
 
. : . : . : . : . : . :
JMSF030N10+ AGTCAAATTCGGAGAGGGATAAAATGATAAATCTCGCGATAACAAAAAGCAGCTC
JMSF003I22+ AGTCAAATTCGGAGAGGGATAAAATGATAAATCTCGCGATAACAAAAAGCA
JMSF005A10+ AGTCAAATTCGGAGAGGGATAAAATGATAAATCTCGCGATAACAAAAAGCAGCTC
JMSF022G09+ AGTCAAATTCGGAGAGGGATAAAATGATAAATCTCGCGATAACAAAAAGCAGCTC
JMFS092H02+ AGTCAAATTCGGAGAGGGATAAAATGATAAATCTCG
JMFS150A07+ AGTCAAATTCGGAGAGGGATAAAATGATA
JMFS090F03+ AGTCAAATTCGGAGAGGGATAAAATGATAAATCTCGC
JMSF023H18+ AGTCAAATTCGGAGAGGGATAAAATGATAAATCTCGCGATAACAAAAAGCAGCTCGAAAC
                      ____________________________________________________________
consensus AGTCAAATTCGGAGAGGGATAAAATGATAAATCTCGCGATAACAAAAAGCAGCTCGAAAC