Previous Contig 006144:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019E14Sequence608006144 (6)gb:AP002842_18230767e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMFF030L11Sequence608006144 (6)gb:AP002842_18230767e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN757003058 (7)pir|T52121|T521215e-81acyl-CoA oxidase (EC 1.3.3.6), peroxisomal [validated] - Arabidopsis thaliana>gb
JMFF033I14Sequence477006144 (6)gb:AP002842_18230766e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN810003058 (7)pir|T52121|T521211e-88acyl-CoA oxidase (EC 1.3.3.6), peroxisomal [validated] - Arabidopsis thaliana>gb
JMSF014D17Sequence481006144 (6)gb:AP002842_18230764e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN759003058 (7)pir|T52121|T521211e-89acyl-CoA oxidase (EC 1.3.3.6), peroxisomal [validated] - Arabidopsis thaliana>gb
JMSF023G21Sequence695006144 (6)gb:AP002842_18230763e-75Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN765003058 (7)gb:AF404404_17967285e-68Glycine max acyl-CoA oxidase (ACX1;2) mRNA, complete cds.
JMSF034N01Sequence678006144 (6)gb:AP002842_18230761e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN707003058 (7)gb:AF404404_17967281e-77Glycine max acyl-CoA oxidase (ACX1;2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034N01+ ATAAGACGTGCATAAACAACTG
                      ____________________________________________________________
consensus ATAAGACGTGCATAAACAACTG
 
. : . : . : . : . : . :
JMSF034N01+ CATGGGTAGAGACTTTACCCAATCCACCGGGCCACCACTTGCTTGAAGTCAGTGTAGGAC
JMFF030L11+ AAGTCAGTGTAGGAC
JMFF019E14+ AAGTCAGTGTAGGAC
JMSF023G21+ ACCGGGCCACCACTTGCTTGAAGTCAGTGTAGGAC
                      ____________________________________________________________
consensus CATGGGTAGAGACTTTACCCAATCCACCGGGCCACCACTTGCTTGAAGTCAGTGTAGGAC
 
. : . : . : . : . : . :
JMSF034N01+ TGTGAATAATAAATTCACCAGTTCGGGGATCAAAAGTGGCAGTGGTTTCAAGGCCTTGCA
JMFF030L11+ TGTGAATAATAAATTCATCAGTTCGGGGATCAAAAGTGGCAGTGGTTTCAAGGCCTTGCA
JMFF019E14+ TGTGAATAATAAATTCATCAGTTCGGGGATCAAAAGTGGCAGTGGTTTCAAGGCCTTGCA
JMSF023G21+ TGTGAATAATAAATTCATCAGTTCGGGGATCAAAAGTGGCAGTGGTTTCAAGGCCTTGCA
                      ____________________________________________________________
consensus TGTGAATAATAAATTCATCAGTTCGGGGATCAAAAGTGGCAGTGGTTTCAAGGCCTTGCA
 
. : . : . : . : . : . :
JMSF034N01+ CGTTCGATCCATGACCAAGCTCAGTTTGTGCGTAGCAGCCAATAATTTCCATTTTGTAGG
JMFF030L11+ CGTTCGATCCATGACCAAGCTCAGTTTGTGCGTAGCAGCCAATAATTTCCATTTTGTAGG
JMFF019E14+ CGTTCGATCCATGACCAAGCTCAGTTTGTGCGTAGCAGCCAATAATTTCCATTTTGTAGG
JMFF033I14+ GG
JMSF023G21+ CGTTCGATCCATGACCAAGCTCAGTTTGTGCGTAGCAGCCAATAATTTCCATTTTGTAGG
                      ____________________________________________________________
consensus CGTTCGATCCATGACCAAGCTCAGTTTGTGCGTAGCAGCCAATAATTTCCATTTTGTAGG
 
. : . : . : . : . : . :
JMSF034N01+ CCAACGGTAACCACTTCTTTTGCTGTTCTTCGGTGCCCGATCCTTTTATGGCAGGTACAA
JMFF030L11+ CCAACGGTAACCACTTCTTTTGCTGTTCTTCGGTGCCCGATCCTTTTATGGCAGGTACAA
JMFF019E14+ CCAACGGTAACCACTTCTTTTGCTGTTCTTCGGTGCCCGATCCTTTTATGGCAGGTACAA
JMSF014D17+ TATGGCAGGTACAA
JMFF033I14+ CCAACGGTAACCACTTCTTTTGCTGTTCTTCGGTGCCCGATCCTTTTATGGCAGGTACAA
JMSF023G21+ CCAACGGTAACCACTTCTTTTGCTGTTCTTCGGTGCCCGATCCTTTTATGGCAGGTACAA
                      ____________________________________________________________
consensus CCAACGGTAACCACTTCTTTTGCTGTTCTTCGGTGCCCGATCCTTTTATGGCAGGTACAA
 
. : . : . : . : . : . :
JMSF034N01+ ACATACCCCAATGAAGGTCAGTATACGCAGGCTCATCCATATAGAACCTAAACTTTCGTG
JMFF030L11+ ACATACCCCAATGAAGGTCAGTATACGCAGGCTCATCCATATAGAACCTAAACTTTCGTG
JMFF019E14+ ACATACCCCAATGAAGGTCAGTATACGCAGGCTCATCCATATAGAACCTAAACTTTCGTG
JMSF014D17+ ACATACCCCAATGAAGGTCAGTATACGCAGGCTCATCCATATAGAACCTAAACTTTCGTG
JMFF033I14+ ACATACCCCAATGAAGGTCAGTATACGCAGGCTCATCCATATAGAACCTAAACTTTCGTG
JMSF023G21+ ACATACCCCAATGAAGGTCAGTATACGCAGGCTCATCCATATAGAACCTAAACTTTCGTG
                      ____________________________________________________________
consensus ACATACCCCAATGAAGGTCAGTATACGCAGGCTCATCCATATAGAACCTAAACTTTCGTG
 
. : . : . : . : . : . :
JMSF034N01+ CCTCTTCCTCGGTAAGACGAAGTTCATTGATTAGTTTCCAGGCATGATTCACCTTCCTCA
JMFF030L11+ CCTCTTCCTCGGTAAGACGAAGTTCATTGATTAGTTTCCAGGCATGATTCACCTTCCTCA
JMFF019E14+ CCTCTTCCTCGGTAAGACGAAGTTCATTGATTAGTTTCCAGGCATGATTCACCTTCCTCA
JMSF014D17+ CCTCTTCCTCGGTAAGACGAAGTTCATTGATTAGTTTCCAGGCATGATTCACCTTCCTCA
JMFF033I14+ CCTNTTCCTCGGTAAGACGAAGTTCATTGATTAGTTTCCAGGCATGATTCACCTTCCTCA
JMSF023G21+ CCTCTTCCTCGGTAAGACGAAGTTCATTGATTAGTTTCCAGGCATGATTCACCTTCCTCA
                      ____________________________________________________________
consensus CCTCTTCCTCGGTAAGACGAAGTTCATTGATTAGTTTCCAGGCATGATTCACCTTCCTCA
 
. : . : . : . : . : . :
JMSF034N01+ GTGCATTCTTAAACAATTCCTTCCTTGGCATCATAGTTCTGCCCTCCTTACTAAGAGCAG
JMFF030L11+ GTGCATTCTTAAACAATTCCTTCCTTGGCATCATAGTTCTGCCCTCCTTACTAAGAGCAG
JMFF019E14+ GTGCATTCTTAAACAATTCCTTCCTTGGCATCATAGTTCTGCCCTCCTTACTAAGAGCAG
JMSF014D17+ GTGCATTCTTAAACAATTCCTTCCTTGGCATCATAGTTCTGCCCTCCTTACTAAGAGCAG
JMFF033I14+ GTGCATTCTTAAACAATTCCTTCCTTGGCATCATAGTTCTGCCCTCCTTACTAAGAGCAG
JMSF023G21+ GTGCATTCTTAAACAATTCCTTCCTTGGCATCATAGTTCTGCCCTCCTTACTAAGAGCAG
                      ____________________________________________________________
consensus GTGCATTCTTAAACAATTCCTTCCTTGGCATCATAGTTCTGCCCTCCTTACTAAGAGCAG
 
. : . : . : . : . : . :
JMSF034N01+ GATCGCTGGCAACGAGCTTGGAGATACGGTCATGGAGTTGAAATTCAGATAGAGAGCCGG
JMFF030L11+ GATCGCTGGCAACGAGCTTGGAGATACGGTCATGGAGTTGAAATTCAGATAGAGAGCCGG
JMFF019E14+ GATCGCTGGCAACGAGCTTGGAGATACGGTCATGGAGTTGAAATTCAGATAGAGAGCCGG
JMSF014D17+ GATCGCTGGCAACGAGCTTGGAGATACGGTCATGGAGTTGAAATTCAGATAGAGAGCCGG
JMFF033I14+ GATCGCTGGCAACGAGCTTGGAGATACGGTCATGGAGTTGAAATTCAGATAGAGAGCCGG
JMSF023G21+ GATCGCTGGCAACGAGCTTGGAGATACGGTCATGGAGTTGAAATTCAGATAGAGAGCCGG
                      ____________________________________________________________
consensus GATCGCTGGCAACGAGCTTGGAGATACGGTCATGGAGTTGAAATTCAGATAGAGAGCCGG
 
. : . : . : . : . : . :
JMSF034N01+ CCCAAGCGATCTTCATTGCATCAACGTCAAACTCAGCCTTCCTCCTCTCGCCGGCCAAGA
JMFF030L11+ CCCAAGCGATCTTCATTGCATCAACGTCAAACTCAGCCTTCCTCCTCTCGCCGGCCAAGA
JMFF019E14+ CCCAAGCGATCTTCATTGCATCAACGTCAAACTCAGCCTTCCTCCTCTCGCCGGCCAAGA
JMSF014D17+ CCCAAGCGATCTTCATTGCATCAACGTCAAACTCAGCCTTCCTCCTCTCGCCGGCCAAGA
JMFF033I14+ CCCAAGCGATCTTCATTGCATCAACGTCAAACTCAGCCTTCCTCCTCTCGCCGGCCAAGA
JMSF023G21+ CCCAAGCGATCTTCATTGCATCAACGTCAAACTCAGCCTTCCTCCTCTCGCCGGCCAAGA
                      ____________________________________________________________
consensus CCCAAGCGATCTTCATTGCATCAACGTCAAACTCAGCCTTCCTCCTCTCGCCGGCCAAGA
 
. : . : . : . : . : . :
JMSF034N01+ AGTCAACGGATGCCATTCTCTTGTGTCTTTCTCTACTGCTCACAAACAAAACCCAGAGCT
JMFF030L11+ AGTCAACGGATGCCATTCTCTTGTGTCTTTCTCTACTGCTCACAAACAAAACCCAGAGCT
JMFF019E14+ AGTCAACGGATGCCATTCTCTTGTGTCTTTCTCTACTGCTCACAAACAAAACCCAGAGCT
JMSF014D17+ AGTCAACGGATGCCATTCTCTTGTGTCTTTCTCTACTGCTCACAAACAAAACCCAGAGCT
JMFF033I14+ AGTCAACGGATGCCATTCTCTTGTGTCTTTCTCTACTGCTCACAAACAAAACCCAGAGCT
JMSF023G21+ AGTCAACGGATGCCATTCTCTTGTGTCTTTCTCTACTGCTCACAAACAAAACCCAGAGCT
                      ____________________________________________________________
consensus AGTCAACGGATGCCATTCTCTTGTGTCTTTCTCTACTGCTCACAAACAAAACCCAGAGCT
 
. : . : . : . : . : . :
JMSF034N01+ CTGATTTGAGAGTAATACACAGAACTCTCGAGTTTATCCCTTAAAAATGAGACGC
JMFF030L11+ CTGATTTGAGAGTAATACACAGAACTCTCGAGTTTATCCCTTAAAAATGAGAC
JMFF019E14+ CTGATTTGAGAGTAATACACAGAACTCTCGAGTTTATCCCTTAAAAATGAGAC
JMSF014D17+ CTGATTTGAGAGTAATACACAGAACTCTCGAGTTTATCCCTTAAAAATGAGACGCGAAAA
JMFF033I14+ CTGATTTGAGAGTAATACACAGAACTCTCGAGTTTATCCCTTAAAAATGAGACGC
JMSF023G21+ CTGATTTGAGAGTAATACACAGAACTCTCGAGTTTATCCCTTAAAAATGAGACGCGAAAA
                      ____________________________________________________________
consensus CTGATTTGAGAGTAATACACAGAACTCTCGAGTTTATCCCTTAAAAATGAGACGCGAAAA
 
. : . : . : . : . : . :
JMSF014D17+ GGAATGGGCACAGCCTTGAAGCCTTTGTAGGTGTGCGGTCTGTGAC
JMSF023G21+ GGAATGGGCACAGCCTTGAAGCCTTTGTAGGTGTGCGGTCTGTGACAATGTGGGACGGTC
                      ____________________________________________________________
consensus GGAATGGGCACAGCCTTGAAGCCTTTGTAGGTGTGCGGTCTGTGACAATGTGGGACGGTC