Previous Contig 006140:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004A12Sequence230006140 (2)gb:AY311597_15981634e-11Gossypium hirsutum class III peroxidase (pod7) mRNA, complete cds.413022104sp|Q8W4J9|RPP8_ARATH3e-09Disease resistance protein RPP8 (Resistance to Peronospora parasitica protein 8)
JMSF023F17Sequence690006140 (2)gb:AY443342_16063589e-73Quercus suber peroxidase precursor (POX1) gene, complete cds; and microsatellite

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023F17+ TGATAAAGCAACCATATCCCTAGCAGAGAG
                      ____________________________________________________________
consensus TGATAAAGCAACCATATCCCTAGCAGAGAG
 
. : . : . : . : . : . :
JMSF023F17+ ACCTTTGTTTTGGAACCTTGTGATGAGATTGTTGAGCGTTGCTGTCGGAGGTGGGATTAC
                      ____________________________________________________________
consensus ACCTTTGTTTTGGAACCTTGTGATGAGATTGTTGAGCGTTGCTGTCGGAGGTGGGATTAC
 
. : . : . : . : . : . :
JMSF023F17+ ACCGCTGTTGGCTGCAGACAGGCTGGCTGTTTTGGAGTCTCTCCTTCCGAGTTTCACATT
                      ____________________________________________________________
consensus ACCGCTGTTGGCTGCAGACAGGCTGGCTGTTTTGGAGTCTCTCCTTCCGAGTTTCACATT
 
. : . : . : . : . : . :
JMSF023F17+ CCAGTTTGGTCCTCCAAGCAAAACAACCGAGTCACGAGCAGCAATAGTGACAATATCTGC
                      ____________________________________________________________
consensus CCAGTTTGGTCCTCCAAGCAAAACAACCGAGTCACGAGCAGCAATAGTGACAATATCTGC
 
. : . : . : . : . : . :
JMSF023F17+ ACAAGACACAACGCCTGGACATACTTTTTCAACTGCCGATTTGATGCTGTCAATGACATT
                      ____________________________________________________________
consensus ACAAGACACAACGCCTGGACATACTTTTTCAACTGCCGATTTGATGCTGTCAATGACATT
 
. : . : . : . : . : . :
JMSF023F17+ GAACCCCCTAACAGAATTGTTGTTAGGACCAGCAGTTTTTTCTCCAGTAAAGGAAGAGGT
                      ____________________________________________________________
consensus GAACCCCCTAACAGAATTGTTGTTAGGACCAGCAGTTTTTTCTCCAGTAAAGGAAGAGGT
 
. : . : . : . : . : . :
JMSF023F17+ ATCGTCTAGAAGAATGGATCCATCGCAACCTTGGACAAAGCAATCATGGAAGTGGAGGCG
                      ____________________________________________________________
consensus ATCGTCTAGAAGAATGGATCCATCGCAACCTTGGACAAAGCAATCATGGAAGTGGAGGCG
 
. : . : . : . : . : . :
JMSF004A12+ GCGAAGCACCCATACGCTTTTCCTTGTTGACTGCAGATTTTACGACTGATTTTAC
JMSF023F17+ AAGGAGCGAAGCACCCATACGCTTTTCCTTGTTGACTGCAGATTTTACGACTGATTTTAC
                      ____________________________________________________________
consensus AAGGAGCGAAGCACCCATACGCTTTTCCTTGTTGACTGCAGATTTTACGACTGATTTTAC
 
. : . : . : . : . : . :
JMSF004A12+ AGTAGCAAGCAACTTGGGACAACTCTTGGAGTAGAAATTGGTGGAGAGCTGCGCAGAAGT
JMSF023F17+ AGTAGCAAGCAACTTGGGACAACTCTTGGAGTAGAAATTGGTGGAGAGCTGCGCAGAAGT
                      ____________________________________________________________
consensus AGTAGCAAGCAACTTGGGACAACTCTTGGAGTAGAAATTGGTGGAGAGCTGCGCAGAAGT
 
. : . : . : . : . : . :
JMSF004A12+ GCTACCCGACAACATGGAAATAACAAGAACAATCAAAACGACCATCATTCTTGCTCTTGT
JMSF023F17+ GCTACCCGACAACATGGAAATAACAAGAACAATCAAAACGACCATCATTCTTGCTCTTGT
                      ____________________________________________________________
consensus GCTACCCGACAACATGGAAATAACAAGAACAATCAAAACGACCATCATTCTTGCTCTTGT
 
. : . : . : . : . : . :
JMSF004A12+ TGTCCAACAAGATGAAGAAAAAGAAGAAGAAGAAGAAGAAGAAAAAGCAACC
JMSF023F17+ TGTCCAACAAGATGAAGAAAAAGAAGAAGAAGAAGAAGAAGAAAAAGCAACCATTGTACA
                      ____________________________________________________________
consensus TGTCCAACAAGATGAAGAAAAAGAAGAAGAAGAAGAAGAAGAAAAAGCAACCATTGTACA
 
. : . : . : . : . : . :
JMSF023F17+ AATCAAATGCAAACAAGGTTGTTTAGTAGATAATTAACGAGATAATAATGCGTGTGTATC
                      ____________________________________________________________
consensus AATCAAATGCAAACAAGGTTGTTTAGTAGATAATTAACGAGATAATAATGCGTGTGTATC