Previous Contig 006135:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023E08Sequence680006135 (2)gb:BT020354_16427492e-35Arabidopsis thaliana At4g16144 gene, complete cds.743012364 (2)gb:BT020354_16427492e-96Arabidopsis thaliana At4g16144 gene, complete cds.
JMSF024I17Sequence681006135 (2)gb:BT020354_16427492e-35Arabidopsis thaliana At4g16144 gene, complete cds.773012364 (2)gb:BT020354_16427493e-97Arabidopsis thaliana At4g16144 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024I17+ GAAGAGGTAAAGAGAGAGATA
JMSF023E08+ AAGAGGTAAAGAGAGAGATA
                      ____________________________________________________________
consensus GAAGAGGTAAAGAGAGAGATA
 
. : . : . : . : . : . :
JMSF024I17+ GCTTTNGGAACTGCAAGTCTATGGAATTCAATGATGAAACTTGAGGGTGATCATTGTTCT
JMSF023E08+ GCTTTNGGAACTGCAAGTCTATGGAATTCAATGATGAAACTTGAGGGTGATCATTGTTCT
                      ____________________________________________________________
consensus GCTTTNGGAACTGCAAGTCTATGGAATTCAATGATGAAACTTGAGGGTGATCATTGTTCT
 
. : . : . : . : . : . :
JMSF024I17+ GCTTCCATGAAGAAGTTGTGCTGCTGACAGCCCACTTATTGTCATAGCCTGAAGATGCTT
JMSF023E08+ GCTCCCATGAAGAAGTTGTGCTGCTGACAGCCCACTTATTGTCATAGCCTGAAGATGCTT
                      ____________________________________________________________
consensus GCTTCCATGAAGAAGTTGTGCTGCTGACAGCCCACTTATTGTCATAGCCTGAAGATGCTT
 
. : . : . : . : . : . :
JMSF024I17+ TATTGTCCAATGCGGGCCGCCCTAAAGAATTCCTTGATGATACAGTTGGAGTAATTTCGG
JMSF023E08+ TATTGTCCAATGCGGGCCGCCCTAAAGAATTCCTTGATGATACAGTTGGAGTAATTTCGG
                      ____________________________________________________________
consensus TATTGTCCAATGCGGGCCGCCCTAAAGAATTCCTTGATGATACAGTTGGAGTAATTTCGG
 
. : . : . : . : . : . :
JMSF024I17+ AACACTCAAGTTGATAAGGTTGAGCTGTCACTTGACGTTTTTCCAGTTCATTCACTTGAC
JMSF023E08+ AACACTCAAGTTGATAAGGTTGAGCTGTCACTTGACGTTTTTCCAGTTCATTCACTTGAC
                      ____________________________________________________________
consensus AACACTCAAGTTGATAAGGTTGAGCTGTCACTTGACGTTTTTCCAGTTCATTCACTTGAC
 
. : . : . : . : . : . :
JMSF024I17+ GTAGGAACGTTGGCTTTAGAGCCTCTAGCTCATCTAGCACTCTTAAAAGTGTCTTTCTTG
JMSF023E08+ GTAGGAACGTTGGCTTTAGAGCCTCTAGCTCATCTAGCACTCTTAAAAGTGTCTTTCTTG
                      ____________________________________________________________
consensus GTAGGAACGTTGGCTTTAGAGCCTCTAGCTCATCTAGCACTCTTAAAAGTGTCTTTCTTG
 
. : . : . : . : . : . :
JMSF024I17+ AAGATGTTCTTTCTTTTGGATACAGAGCCAGGTAATCTCGATGGCAGGGTATAGTTTCAG
JMSF023E08+ AAGATGTTCTTTCTTTTGGATACAGAGCCAGGTAATCTCGATGGCAGGGTATAGTTTCAG
                      ____________________________________________________________
consensus AAGATGTTCTTTCTTTTGGATACAGAGCCAGGTAATCTCGATGGCAGGGTATAGTTTCAG
 
. : . : . : . : . : . :
JMSF024I17+ TCAACAAACTGGAATATCTAAGCAGCATTATATACAAATCAATAATGTTCTTCTCTCCCC
JMSF023E08+ TCAACAAACTGGAATATCTAAGCAGCATTATATACAAATCAATAATGTTCTTCTCTCCCC
                      ____________________________________________________________
consensus TCAACAAACTGGAATATCTAAGCAGCATTATATACAAATCAATAATGTTCTTCTCTCCCC
 
. : . : . : . : . : . :
JMSF024I17+ GGTAGATATTTGCCTGCCGGAGTATATTATCCGCGATCCGATAGTAATTGCGAAGTGGTA
JMSF023E08+ GGTAGATATTTGCCTGCCGGAGTATATTATCCGCGATCCGATAGTAATTGCGAAGTGGTA
                      ____________________________________________________________
consensus GGTAGATATTTGCCTGCCGGAGTATATTATCCGCGATCCGATAGTAATTGCGAAGTGGTA
 
. : . : . : . : . : . :
JMSF024I17+ TTCGATTGTCGACGTCGACCTTCCGGGTCATGACACTGACGTTGATCGACGGCCGACTCA
JMSF023E08+ TTCGATTGTCGACGTCGACCTTCCGGGTCATGACACTGACGTTGATCGACGGCCGACTCA
                      ____________________________________________________________
consensus TTCGATTGTCGACGTCGACCTTCCGGGTCATGACACTGACGTTGATCGACGGCCGACTCA
 
. : . : . : . : . : . :
JMSF024I17+ TGTTTAAGGACTCCGAATAATACCGAAGTTAATTTCCCGGTTAATATACGGCGAGTTTAA
JMSF023E08+ TGTTTAAGGACTCCGAATAATACCGAAGTTAATTTCCCGGTTAATATACGGCGAGTTTAA
                      ____________________________________________________________
consensus TGTTTAAGGACTCCGAATAATACCGAAGTTAATTTCCCGGTTAATATACGGCGAGTTTAA
 
. : . : . : . : . : . :
JMSF024I17+ GGTAGCCTGGCCGCAAAGACTTGAGCAGAAACTAATTTGGTTTAATTTGCCTCTCTGTT
JMSF023E08+ GGTAGCCTGGCCGCAAAGACTTGAGCAGAAACTAATTTGGTTTAATTTGCCTCTCTGTTG
                      ____________________________________________________________
consensus GGTAGCCTGGCCGCAAAGACTTGAGCAGAAACTAATTTGGTTTAATTTGCCTCTCTGTTG