Previous Contig 006132:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023D20Sequence657006132 (3)gb:AY085034_15701163e-66Arabidopsis thaliana clone 125131 mRNA, complete sequence.782006132 (3)gb:AY091082_15743091e-50Arabidopsis thaliana putative cell differentiation protein (At3g20800) mRNA, com
JMSF043L01Sequence794006132 (3)gb:AY085034_15701164e-94Arabidopsis thaliana clone 125131 mRNA, complete sequence.561013500 (8)pir|H86347|H863471e-10hypothetical protein F24J8.11 - Arabidopsis thaliana>gb:AE005172_891099 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023D20- TTTATTTTATAAACATAAAGATGTTAAAATAATAACTTATCTTAAAACACTACTCTAA
                      ____________________________________________________________
consensus TTTATTTTATAAACATAAAGATGTTAAAATAATAACTTATCTTAAAACACTACTCTAA
 
. : . : . : . : . : . :
rJMSF023D20- GTAACGCTTAAAAAATAAGCTAGTAGCTATTAGCTTTAAACTAGCTTAAAAGCTAAATAT
                      ____________________________________________________________
consensus GTAACGCTTAAAAAATAAGCTAGTAGCTATTAGCTTTAAACTAGCTTAAAAGCTAAATAT
 
. : . : . : . : . : . :
rJMSF023D20- GCCAAATAGAGCCTAGCTCTTGAAATATGTGAACCCTAAGCTAGGAAAAAGAGTTTAAAT
                      ____________________________________________________________
consensus GCCAAATAGAGCCTAGCTCTTGAAATATGTGAACCCTAAGCTAGGAAAAAGAGTTTAAAT
 
. : . : . : . : . : . :
rJMSF023D20- ACTGTTATTGGGTAACATAAATAATAGAAGTCGATAGAGTCTGCAAATATCTGAACTTTT
                      ____________________________________________________________
consensus ACTGTTATTGGGTAACATAAATAATAGAAGTCGATAGAGTCTGCAAATATCTGAACTTTT
 
. : . : . : . : . : . :
rJMSF023D20- TACGTTCCTGGAGATTGAGGTTACTGCACAATCAATGGGAAAAATTTTAACCTCAATGTA
                      ____________________________________________________________
consensus TACGTTCCTGGAGATTGAGGTTACTGCACAATCAATGGGAAAAATTTTAACCTCAATGTA
 
. : . : . : . : . : . :
rJMSF023D20- GAGCGAAAGAACTTCTCTGGGGATTTTACGTTCAGGCTTTACTATATGCAGCAGATTCAC
                      ____________________________________________________________
consensus GAGCGAAAGAACTTCTCTGGGGATTTTACGTTCAGGCTTTACTATATGCAGCAGATTCAC
 
. : . : . : . : . : . :
rJMSF023D20- AACGAGGTCAGGTCAAGCCAATTTAGCTCACCAGCATACGATCAAATCCTCCGCCTGCTT
                      ____________________________________________________________
consensus AACGAGGTCAGGTCAAGCCAATTTAGCTCACCAGCATACGATCAAATCCTCCGCCTGCTT
 
. : . : . : . : . : . :
rJMSF023D20- GAAGGGAAGCACAAGGACCTTGCACATTCTGAAGCAGCTGTTGAAGCCACCTCCTTGTTG
                      ____________________________________________________________
consensus GAAGGGAAGCACAAGGACCTTGCACATTCTGAAGCAGCTGTTGAAGCCACCTCCTTGTTG
 
. : . : . : . : . : . :
rJMSF023D20- TTGGATCCTCATGAAGGCAATTGCTGAAGGTGGTGGCATCCCTAAGTATGTCTGGAAGAC
                      ____________________________________________________________
consensus TTGGATCCTCATGAAGGCAATTGCTGAAGGTGGTGGCATCCCTAAGTATGTCTGGAAGAC
 
. : . : . : . : . : . :
rJMSF023D20- AACTTCTGAGTGCATCGCAAGCCCTTGGATTATCAGATAACCGAAGGTAACACCGAATGA
                      ____________________________________________________________
consensus AACTTCTGAGTGCATCGCAAGCCCTTGGATTATCAGATAACCGAAGGTAACACCGAATGA
 
. : . : . : . : . : . :
rJMSF023D20- TATGCTTGAGCAACCTAGACGAGGGCTGCTCAGCAAGTGCAACCACCATGTTTCCCAACA
                      ____________________________________________________________
consensus TATGCTTGAGCAACCTAGACGAGGGCTGCTCAGCAAGTGCAACCACCATGTTTCCCAACA
 
. : . : . : . : . : . :
rJMSF023D20- CCCTGCCTACAGCAAAAAACCTCTCCGCCGTGGTACATATGTATTCCAAACCCATATCAT
JMSF043L01+ TCCGCCGTGGTACATATGTATTCCAAACCCATATCAT
                      ____________________________________________________________
consensus CCCTGCCTACAGCAAAAAACCTCTCCGCCGTGGTACATATGTATTCCAAACCCATATCAT
 
. : . : . : . : . : . :
rJMSF023D20- CCAGAAGGATTTTTTGCACAATGAAAGTTGCAACTGTTTTTGAGAGCTCACTGCCCATCT
JMSF043L01+ CCAGAAGGATTTTTTGCACAATGAAAGTTGCAACTGTTTTTGAGAGCTCACTGCCCATCT
                      ____________________________________________________________
consensus CCAGAAGGATTTTTTGCACAATGAAAGTTGCAACTGTTTTTGAGAGCTCACTGCCCATCT
 
. : . : . : . : . : . :
rJMSF023D20- CC
JMSF043L01+ CCATTGTGCGCAGACAGAGTGGAATTATTTCAGTTGATAGAAGGAAATTGATAACATCAT
                      ____________________________________________________________
consensus CCATTGTGCGCAGACAGAGTGGAATTATTTCAGTTGATAGAAGGAAATTGATAACATCAT
 
. : . : . : . : . : . :
JMSF043L01+ TGTCATCAACCTTTACCAGGGCACCAATGACACCTAAGCTAGTAAGCCTCAGGTATTCAA
JMSF023D20+ CATCAACCTTTACCAGGGCACCAATGACACCTAAGCTAGTAAGCCTCAGGTATTCAA
                      ____________________________________________________________
consensus TGTCATCAACCTTTACCAGGGCACCAATGACACCTAAGCTAGTAAGCCTCAGGTATTCAA
 
. : . : . : . : . : . :
JMSF043L01+ AAGGTCTTGATTTGCTTGTTGTATTAAGAAAAGGATACAAATACAGAGGAATATGAGCAT
JMSF023D20+ AAGGTCTTGATTTGCTTGTTGTATTAAGAAAAGGATACAAATACAGAGGAATATGAGCAT
                      ____________________________________________________________
consensus AAGGTCTTGATTTGCTTGTTGTATTAAGAAAAGGATACAAATACAGAGGAATATGAGCAT
 
. : . : . : . : . : . :
JMSF043L01+ TAAGGAACAGCATTCTGGTGTCTGGGTGAGAGGCTACGCACTGAAGAAGTGCGAGTGCAT
JMSF023D20+ TAAGGAACAGCATTCTGGTGTCTGGGTGAGAGGCTACGCACTGAAGAAGTGCGAGTGCAT
                      ____________________________________________________________
consensus TAAGGAACAGCATTCTGGTGTCTGGGTGAGAGGCTACGCACTGAAGAAGTGCGAGTGCAT
 
. : . : . : . : . : . :
JMSF043L01+ TGCAAACTCTATTAGATTGAGCAGGAGTGAGGTTTGGTGGTGACAAAACTGGGTAGATGG
JMSF023D20+ TGCAAACTCTATTAGATTGAGCAGGAGTGAGGTTTGGTGGTGACAAAACTGGGTAGATGG
                      ____________________________________________________________
consensus TGCAAACTCTATTAGATTGAGCAGGAGTGAGGTTTGGTGGTGACAAAACTGGGTAGATGG
 
. : . : . : . : . : . :
JMSF043L01+ AGACAATTTCCTGCAAGAGTGCAGCAATAGTACCAAATGAATTCCATAGTAGTGGGGCCA
JMSF023D20+ AGACAATTTCCTGCAAGAGTGCAGCAATAGTACCAAATGAATTCCATAGTAGTGGGGCCA
                      ____________________________________________________________
consensus AGACAATTTCCTGCAAGAGTGCAGCAATAGTACCAAATGAATTCCATAGTAGTGGGGCCA
 
. : . : . : . : . : . :
JMSF043L01+ AATCTTGAAATAGTTCTCTCTTCTTGGAGAGCTCGAGAAGAGCGTTCTCTCGGAGATCAG
JMSF023D20+ AATCTTGAAATAGTTCTCTCTTCTTGGAGAGCTCGAGAAGAGCGTTCTCTCGGAGATCAG
                      ____________________________________________________________
consensus AATCTTGAAATAGTTCTCTCTTCTTGGAGAGCTCGAGAAGAGCGTTCTCTCGGAGATCAG
 
. : . : . : . : . : . :
JMSF043L01+ GATTGCTGAGGTCGAGCACGAGCTGCTCAGCAGATTGCATTTTGCGTTCCTTGTTGGGCT
JMSF023D20+ GATTGCTGAGGTCGAGCACGAGCTGCTCAGCAGATTGCATTTTGCGTTCCTTGTTGGGCT
                      ____________________________________________________________
consensus GATTGCTGAGGTCGAGCACGAGCTGCTCAGCAGATTGCATTTTGCGTTCCTTGTTGGGCT
 
. : . : . : . : . : . :
JMSF043L01+ GAGCGCCGACGGCGGTGGCGGAGGAAGAGCCAGGACCTCCTCCGAAAGCGGCGGCGGCGC
JMSF023D20+ GAGCGCCGACGGCGGTGGCGGAGGAAGAGCCAGGACCTCCTCCGAAAGCGGCGGCGGCGC
                      ____________________________________________________________
consensus GAGCGCCGACGGCGGTGGCGGAGGAAGAGCCAGGACCTCCTCCGAAAGCGGCGGCGGCGC
 
. : . : . : . : . : . :
JMSF043L01+ CCATCGAGAGATTCGGAGGGAGATTAGCCATGTATCTCAGTTTTACTCAGATTCTACTTC
JMSF023D20+ CCATCGAGAGATTCGGAGGGAGATTAGCCATGTATCTCAGTTTTACTCAGATTCTACTTC
                      ____________________________________________________________
consensus CCATCGAGAGATTCGGAGGGAGATTAGCCATGTATCTCAGTTTTACTCAGATTCTACTTC
 
. : . : . : . : . : . :
JMSF043L01+ TGTCCAATACTGGAATGGGAGGAAAATCTGGAAACGGCTGAACGGAGAAGCAGGCAAATA
JMSF023D20+ TGTCCAATACTGGAATGGGAGGAAAATCTGGAAACGGCTGAACGGAGAAGCAGGCAAATA
                      ____________________________________________________________
consensus TGTCCAATACTGGAATGGGAGGAAAATCTGGAAACGGCTGAACGGAGAAGCAGGCAAATA
 
. : . : . : . : . : . :
JMSF043L01+ TGTCAGTGAAGTTTGATTCAAAAGTGGCGTTGCGC
JMSF023D20+ TGTCAGTGAAGTTTGATTCAAAAGTGGCGTTGCGCTGCTGTTACACGTGCCTGGCTGACC
                      ____________________________________________________________
consensus TGTCAGTGAAGTTTGATTCAAAAGTGGCGTTGCGCTGCTGTTACACGTGCCTGGCTGACC